Search Results Heading

MBRLSearchResults

mbrl.module.common.modules.added.book.to.shelf
Title added to your shelf!
View what I already have on My Shelf.
Oops! Something went wrong.
Oops! Something went wrong.
While trying to add the title to your shelf something went wrong :( Kindly try again later!
Are you sure you want to remove the book from the shelf?
Oops! Something went wrong.
Oops! Something went wrong.
While trying to remove the title from your shelf something went wrong :( Kindly try again later!
    Done
    Filters
    Reset
  • Discipline
      Discipline
      Clear All
      Discipline
  • Is Peer Reviewed
      Is Peer Reviewed
      Clear All
      Is Peer Reviewed
  • Item Type
      Item Type
      Clear All
      Item Type
  • Subject
      Subject
      Clear All
      Subject
  • Year
      Year
      Clear All
      From:
      -
      To:
  • More Filters
45 result(s) for "Borbone, Nicola"
Sort by:
Nucleoside Analogs and Nucleoside Precursors as Drugs in the Fight against SARS-CoV-2 and Other Coronaviruses
Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively. The easily transmissible SARS-CoV-2, emerging at the end of 2019 in China, spread rapidly worldwide, leading the World Health Organization (WHO) to declare COVID-19 a pandemic. While the world waits for mass vaccination, there is an urgent need for effective drugs as short-term weapons to combat the SARS-CoV-2 infection. In this context, the drug repurposing approach is a strategy able to guarantee positive results rapidly. In this regard, it is well known that several nucleoside-mimicking analogs and nucleoside precursors may inhibit the growth of viruses providing effective therapies for several viral diseases, including HCoV infections. Therefore, this review will focus on synthetic nucleosides and nucleoside precursors active against different HCoV species, paying great attention to SARS-CoV-2. This work covers progress made in anti-CoV therapy with nucleoside derivatives and provides insight into their main mechanisms of action.
(2R,3R,5R,6S)-5-Bromo-2-(2R,3R,5R)-3-bromo-5-(propa-1,2-dien-1-yl)tetrahydro-furan-2-ylmethyl-6-ethyltetrahydro-2H-pyran-3-ol
As a part of an SAR study aimed at testing the antitumor activity of some C15 acetogenins related to mycalin A, we report here the synthesis of the C-1 debromo-derivative of laurenciallene, a substance recently isolated from the red alga Laurencia obtusa. This new substance has been obtained by the selective, reductive debromination of the terminal bromoallene moiety of laurenciallene with Zn/AcOH. Its structure has been fully characterized by spectral methods, including 2D-NMR spectra.
Assisting PNA transport through cystic fibrosis human airway epithelia with biodegradable hybrid lipid-polymer nanoparticles
Cystic fibrosis (CF) is characterized by an airway obstruction caused by a thick mucus due to a malfunctioning Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) protein. The sticky mucus restricts drugs in reaching target cells limiting the efficiency of treatments. The development of new approaches to enhance drug delivery to the lungs represents CF treatment's main challenge. In this work, we report the production and characterization of hybrid core–shell nanoparticles (hNPs) comprising a PLGA core and a dipalmitoylphosphatidylcholine (DPPC) shell engineered for inhalation. We loaded hNPs with a 7-mer peptide nucleic acid (PNA) previously considered for its ability to modulate the post-transcriptional regulation of the CFTR gene. We also investigated the in vitro release kinetics of hNPs and their efficacy in PNA delivery across the human epithelial airway barrier using an ex vivo model based on human primary nasal epithelial cells (HNEC) from CF patients. Confocal analyses and hNPs transport assay demonstrated the ability of hNPs to overcome the mucus barrier and release their PNA cargo within the cytoplasm, where it can exert its biological function.
Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.
Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin
Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.
Porous Silicon-Based Aptasensors: The Next Generation of Label-Free Devices for Health Monitoring
Aptamers are artificial nucleic acid ligands identified and obtained from combinatorial libraries of synthetic nucleic acids through the in vitro process SELEX (systematic evolution of ligands by exponential enrichment). Aptamers are able to bind an ample range of non-nucleic acid targets with great specificity and affinity. Devices based on aptamers as bio-recognition elements open up a new generation of biosensors called aptasensors. This review focuses on some recent achievements in the design of advanced label-free optical aptasensors using porous silicon (PSi) as a transducer surface for the detection of pathogenic microorganisms and diagnostic molecules with high sensitivity, reliability and low limit of detection (LoD).
Exploring a peptide nucleic acid-based antisense approach for CD5 targeting in chronic lymphocytic leukemia
We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies. Cytofluorimetric assays and real-time PCR analysis demonstrated the downregulation of CD5 expression due to incubation with the anti-CD5 PNA at RNA and protein levels in Jurkat cell line and peripheral blood mononuclear cells from B-CLL patients. Interestingly, we also observed that transfection with the anti-CD5 PNA increases apoptotic response induced by fludarabine in B-CLL cells. The herein reported results suggest that PNAs could represent a potential candidate for the development of antisense therapeutic agents in CLL.
Synthesis of Brominated Lactones Related to Mycalin A: Selective Antiproliferative Activity on Metastatic Melanoma Cells and Inhibition of the Cell Migration
Starting from D-xylonolactone and D-ribonolactone, several five-membered bromolactones, related to the C1–C5 portion of mycalin A lactone, have been synthesized. The bromination of D-ribonolactone with HBr/AcOH, without a subsequent transesterification step, has been studied for the first time, giving us most of the acetylated lactones investigated in the present study. For each compound, where possible, both the C-3 alcohol and the corresponding acetate were prepared. Evaluation of their anti-tumor activity showed that all the acetates possess a good cytotoxicity towards human melanoma (A375), human cervical adenocarcinoma (HeLa) and human metastatic melanoma (WM266) cancer cells, comparable or even higher than that displayed by the original mycalin A lactone. Lactone acetates derived from D-ribonolactone showed the higher selectivity of action, exhibiting a strong cytotoxicity on all the tested tumor cells but only a limited toxicity on healthy human dermal fibroblast (HDF) cells, used as a control. Wound healing assays showed that two of these substances inhibit the migration of the WM266 cells.
Investigating the Interactions of Peptide Nucleic Acids with Multicomponent Peptide Hydrogels for the Advancement of Healthcare Technologies
This study reports the development of peptide-based hydrogels for the encapsulation and controlled release of peptide nucleic acids in drug delivery applications. Ultrashort aromatic peptides, such as Fmoc-FF, self-assemble into biocompatible hydrogels with nanostructured architectures. The functionalization of tripeptides (Fmoc-FFK and Fmoc-FFC) with lysine (K) or cysteine (C) enables electrostatic or covalent interactions with model PNAs engineered with glutamic acid or cysteine residues, respectively. Hydrogels were polymerized in situ in the presence of PNAs, and component ratios were systematically varied to optimize mechanical properties, loading efficiency, and release kinetics. The formulations obtained with a 1/10 ratio of Fmoc-FF(K or C)/Fmoc-FF provided an optimal balance between structural integrity and delivery performance. All hydrogel formulations demonstrated high stiffness (G′ > 19,000 Pa), excellent water retention, and minimal swelling under physiological conditions (ΔW < 4%). The release studies over 10 days showed that electrostatic loading enabled faster and higher release (up to 90%), while covalent bonding resulted in slower, sustained delivery (~15%). These findings highlight the tunability of the hydrogel system for diverse therapeutic applications.
Exploring the Relationship between G-Quadruplex Nucleic Acids and Plants: From Plant G-Quadruplex Function to Phytochemical G4 Ligands with Pharmaceutic Potential
G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies. Herein, we describe some G4 structures found in plants, summarizing the existing knowledge of their functions and biological role. Moreover, we review some of the most promising G4 ligands isolated from vegetal sources and report on the known relationships between such phytochemicals and G4-mediated biological processes that make them potential leads in the pharmaceutical sector.