Explore the vast range of titles available.

A combination of Sanger and 454 sequences of small subunit rRNA loci were used to interrogate microbial diversity in the bovine rumen of 12 cows consuming a forage diet. Observed bacterial species richness, based on the V1-V3 region of the 16S rRNA gene, was between 1,903 to 2,432 species-level operational taxonomic units (OTUs) when 5,520 reads were sampled per animal. Eighty percent of species-level OTUs were dominated by members of the order Clostridiales, Bacteroidales, Erysipelotrichales and unclassified TM7. Abundance of Prevotella species varied widely among the 12 animals. Archaeal species richness, also based on 16S rRNA, was between 8 and 13 OTUs, representing 5 genera. The majority of archaeal OTUs (84%) found in this study were previously observed in public databases with only two new OTUs discovered. Observed rumen fungal species richness, based on the 18S rRNA gene, was between 21 and 40 OTUs with 98.4-99.9% of OTUs represented by more than one read, using Good's coverage. Examination of the fungal community identified numerous novel groups. Prevotella and Tannerella were overrepresented in the liquid fraction of the rumen while Butyrivibrio and Blautia were significantly overrepresented in the solid fraction of the rumen. No statistical difference was observed between the liquid and solid fractions in biodiversity of archaea and fungi. The survey of microbial communities and analysis of cross-domain correlations suggested there is a far greater extent of microbial diversity in the bovine rumen than previously appreciated, and that next generation sequencing technologies promise to reveal novel species, interactions and pathways that can be studied further in order to better understand how rumen microbial community structure and function affects ruminant feed efficiency, biofuel production, and environmental impact.

Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment ( att ) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attP core site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs , encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysogenic strains of E. faecalis . We have found no other example of a prophage inserted into ffs , therefore, the ffs locus for ϕEf11 integration represents a novel phage attachment site. SRP functions in the transport of proteins through the cellular membrane to the periplasmic space. Integration into ffs resulted in alteration of the 3’ end of the 4.5 S RNA, where in E. coli , alterations in the same region cause defects in membrane protein insertion. Lysogens of ϕEf11 are resistant to the ϕEf11 endolysin. Since endolysin activity is dependent upon binding to cell surface receptors, it is conceivable that defective SRP function results in alteration of the endolysin receptor, preventing endolysin function.

Chronic liver disease is rising in western countries and liver cirrhosis is the 12th leading cause of death worldwide. Simultaneously, use of gastric acid suppressive medications is increasing. Here, we show that proton pump inhibitors promote progression of alcoholic liver disease, non-alcoholic fatty liver disease, and non-alcoholic steatohepatitis in mice by increasing numbers of intestinal Enterococcus spp. Translocating enterococci lead to hepatic inflammation and hepatocyte death. Expansion of intestinal Enterococcus faecalis is sufficient to exacerbate ethanol-induced liver disease in mice. Proton pump inhibitor use increases the risk of developing alcoholic liver disease among alcohol-dependent patients. Reduction of gastric acid secretion therefore appears to promote overgrowth of intestinal Enterococcus , which promotes liver disease, based on data from mouse models and humans. Recent increases in the use of gastric acid-suppressive medications might contribute to the increasing incidence of chronic liver disease. Proton pump inhibitors (PPIs) reduce gastric acid secretion and modulate gut microbiota composition. Here Llorente et al . show that PPIs induce bacterial overgrowth of enterococci, which, in turn, exacerbate ethanol-induced liver disease both in mice and humans.

Knowledge regarding the genomic structure of Enterobacter spp., the second most prevalent carbapenemase-producing Enterobacteriaceae , remains limited. Here we sequenced 97 clinical Enterobacter species isolates that were both carbapenem susceptible and resistant from various geographic regions to decipher the molecular origins of carbapenem resistance and to understand the changing phylogeny of these emerging and drug-resistant pathogens. Of the carbapenem-resistant isolates, 30 possessed bla KPC-2 , 40 had bla KPC-3 , 2 had bla KPC-4 , and 2 had bla NDM-1 . Twenty-three isolates were carbapenem susceptible. Six genomes were sequenced to completion, and their sizes ranged from 4.6 to 5.1 Mbp. Phylogenomic analysis placed 96 of these genomes, 351 additional Enterobacter genomes downloaded from NCBI GenBank, and six newly sequenced type strains into 19 phylogenomic groups—18 groups (A to R) in the Enterobacter cloacae complex and Enterobacter aerogenes . Diverse mechanisms underlying the molecular evolutionary trajectory of these drug-resistant Enterobacter spp. were revealed, including the acquisition of an antibiotic resistance plasmid, followed by clonal spread, horizontal transfer of bla KPC -harboring plasmids between different phylogenomic groups, and repeated transposition of the bla KPC gene among different plasmid backbones. Group A, which comprises multilocus sequence type 171 (ST171), was the most commonly identified (23% of isolates). Genomic analysis showed that ST171 isolates evolved from a common ancestor and formed two different major clusters; each acquiring unique bla KPC -harboring plasmids, followed by clonal expansion. The data presented here represent the first comprehensive study of phylogenomic interrogation and the relationship between antibiotic resistance and plasmid discrimination among carbapenem-resistant Enterobacter spp., demonstrating the genetic diversity and complexity of the molecular mechanisms driving antibiotic resistance in this genus. IMPORTANCE Enterobacter spp., especially carbapenemase-producing Enterobacter spp., have emerged as a clinically significant cause of nosocomial infections. However, only limited information is available on the distribution of carbapenem resistance across this genus. Augmenting this problem is an erroneous identification of Enterobacter strains because of ambiguous typing methods and imprecise taxonomy. In this study, we used a whole-genome-based comparative phylogenetic approach to (i) revisit and redefine the genus Enterobacter and (ii) unravel the emergence and evolution of the Klebsiella pneumoniae carbapenemase-harboring Enterobacter spp. Using genomic analysis of 447 sequenced strains, we developed an improved understanding of the species designations within this complex genus and identified the diverse mechanisms driving the molecular evolution of carbapenem resistance. The findings in this study provide a solid genomic framework that will serve as an important resource in the future development of molecular diagnostics and in supporting drug discovery programs. Enterobacter spp., especially carbapenemase-producing Enterobacter spp., have emerged as a clinically significant cause of nosocomial infections. However, only limited information is available on the distribution of carbapenem resistance across this genus. Augmenting this problem is an erroneous identification of Enterobacter strains because of ambiguous typing methods and imprecise taxonomy. In this study, we used a whole-genome-based comparative phylogenetic approach to (i) revisit and redefine the genus Enterobacter and (ii) unravel the emergence and evolution of the Klebsiella pneumoniae carbapenemase-harboring Enterobacter spp. Using genomic analysis of 447 sequenced strains, we developed an improved understanding of the species designations within this complex genus and identified the diverse mechanisms driving the molecular evolution of carbapenem resistance. The findings in this study provide a solid genomic framework that will serve as an important resource in the future development of molecular diagnostics and in supporting drug discovery programs.

Alcohol-associated liver disease represents a significant global health challenge, with gut microbial dysbiosis and bacterial translocation playing a critical role in its pathogenesis. Patients with alcohol-associated hepatitis had increased fecal abundance of mammalian viruses, including retroviruses. This study investigated the role of endogenous retroviruses (ERVs) in the development of alcohol-associated liver disease. Transcriptomic analysis of duodenal and liver biopsies revealed increased expression of several human ERVs, including HERV-K and HERV-H, in patients with alcohol-associated liver disease compared with individuals acting as controls. Chronic-binge ethanol feeding markedly induced ERV abundance in intestinal epithelial cells but not the livers of mice. Ethanol increased ERV expression and activated the Z-DNA binding protein 1 (Zbp1)-mixed lineage kinase domain-like pseudokinase (Mlkl) signaling pathways to induce necroptosis in intestinal epithelial cells. Antiretroviral treatment reduced ethanol-induced intestinal ERV expression, stabilized the gut barrier, and decreased liver disease in microbiota-humanized mice. Furthermore, mice with an intestine-specific deletion of Zbp1 were protected against bacterial translocation and ethanol-induced steatohepatitis. These findings indicate that ethanol exploits this pathway by inducing ERVs and promoting innate immune responses, which results in the death of intestinal epithelial cells, gut barrier dysfunction, and liver disease. Targeting the ERV/Zbp1 pathway may offer new therapies for patients with alcohol-associated liver disease.

Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic) vs. non-infectious Leptospira, this work provides new insights into the evolution of a genus of bacterial pathogens. This work will be a comprehensive roadmap for understanding leptospirosis pathogenesis. More generally, it provides new insights into mechanisms by which bacterial pathogens adapt to mammalian hosts.

Background Clinical dogma is that healthy urine is sterile and the presence of bacteria with an inflammatory response is indicative of urinary tract infection (UTI). Asymptomatic bacteriuria (ABU) represents the state in which bacteria are present but the inflammatory response is negligible. Differentiating ABU from UTI is diagnostically challenging, but critical because overtreatment of ABU can perpetuate antimicrobial resistance while undertreatment of UTI can result in increased morbidity and mortality. In this study, we describe key characteristics of the healthy and ABU urine microbiomes utilizing 16S rRNA gene (16S rDNA) sequencing and metaproteomics, with the future goal of utilizing this information to personalize the treatment of UTI based on key individual characteristics. Methods A cross-sectional study of 26 healthy controls and 27 healthy subjects at risk for ABU due to spinal cord injury-related neuropathic bladder (NB) was conducted. Of the 27 subjects with NB, 8 voided normally, 8 utilized intermittent catheterization, and 11 utilized indwelling Foley urethral catheterization for bladder drainage. Urine was obtained by clean catch in voiders, or directly from the catheter in subjects utilizing catheters. Urinalysis, urine culture and 16S rDNA sequencing were performed on all samples, with metaproteomic analysis performed on a subsample. Results A total of 589454 quality-filtered 16S rDNA sequence reads were processed through a NextGen 16S rDNA analysis pipeline. Urine microbiomes differ by normal bladder function vs. NB, gender, type of bladder catheter utilized, and duration of NB. The top ten bacterial taxa showing the most relative abundance and change among samples were Lactobacillales, Enterobacteriales, Actinomycetales, Bacillales, Clostridiales, Bacteroidales, Burkholderiales, Pseudomonadales, Bifidobacteriales and Coriobacteriales. Metaproteomics confirmed the 16S rDNA results, and functional human protein-pathogen interactions were noted in subjects where host defenses were initiated. Conclusions Counter to clinical belief, healthy urine is not sterile. The healthy urine microbiome is characterized by a preponderance of Lactobacillales in women and Corynebacterium in men. The presence and duration of NB and method of urinary catheterization alter the healthy urine microbiome. An integrated approach of 16S rDNA sequencing with metaproteomics improves our understanding of healthy urine and facilitates a more personalized approach to prevention and treatment of infection.

The innate immune system eliminates bloodstream pathogens such as Escherichia coli in part through complement protein deposition and subsequent bacterial death (i.e., “serum killing”). Some E . coli strains have developed mechanisms to resist serum killing, though the extent of variation in serum killing among bloodstream infection (BSI) isolates and the clinical impact of this variation is not well understood. To address this issue, we developed a novel assay that uses flow cytometry to perform high throughput serum bactericidal assays (SBAs) with E . coli BSI isolates (n = 183) to define the proportion of surviving bacteria after exposure to serum. We further determined whether E . coli resistance to serum killing is associated with clinical outcomes (e.g., in-hospital attributable mortality, in-hospital total mortality, septic shock) and bacterial genotype in the corresponding patients with E . coli BSI. Our novel flow cytometry-based SBA performed similarly to a traditional SBA, though with significantly decreased hands-on bench work. Among E . coli BSI isolates, the mean proportion that survived exposure to 25% serum was 0.68 (Standard deviation 0.02, range 0.57–0.93). We did not identify associations between E . coli resistance to serum killing and clinical outcomes in our adjusted models. Together, this study describes a novel flow cytometry-based approach to the bacterial SBA that allowed for high-throughput testing of E . coli BSI isolates and identified high variability in resistance to serum killing among a large set of BSI isolates.

Background: The predominant species in clinical Enterobacter isolates is E. hormaechei . Many articles, clinicians, and GenBank submissions misname these strains as E. cloacae . The lack of sequenced type strains or named species/subspecies for some clades in the E. cloacae complex complicate the issue. Methods: The genomes of the type strains for Enterobacter hormaechei  subsp.  oharae , E .  hormaechei subsp.  steigerwaltii , and E. xiangfangensis , and two strains from Hoffmann clusters III and IV of the E. cloacae complex were sequenced. These genomes, the E .  hormaechei  subsp.  hormaechei type strain, and other available Enterobacter type strains were analysed in conjunction with all extant Enterobacter genomes in NCBI’s RefSeq using Average Nucleotide Identity (ANI). Results: There were five recognizable subspecies of E. hormaechei : E. hormaechei subsp. hoffmannii subsp. nov., E. hormaechei subsp. xiangfangensis comb. nov., and the three previously known subspecies. One of the strains sequenced from the E. cloacae complex was not a novel E. hormaechei subspecies but rather a member of a clade of a novel species: E. roggenkampii sp. nov.. E. muelleri was determined to be a later heterotypic synonym of E. asburiae which should take precedence. Conclusion: The phylogeny of the Enterobacter genus, particularly the cloacae complex, was re-evaluated based on the type strain genome sequences and all other available Enterobacter genomes in RefSeq.

Multiple antibiotic resistance mechanisms, including two β-lactamases, L1, a metallo-β-lactamase, and L2, a class A cephalosporinase, make S. maltophilia naturally multidrug resistant. Thus, infections caused by S. maltophilia pose a big therapeutic challenge. Our study aims to understand the microbiological and molecular characteristics of S. maltophilia isolates recovered from human sources. A highlight of the resistance profile of this collection is the excellent activity of the ceftazidime-avibactam and aztreonam combination. We hope this result prompts controlled and observational studies to add clinical data on the utility and safety of this therapy. We also identify 35 and 43 novel variants of L1 and L2, respectively, some of which harbor novel substitutions that could potentially affect substrate and/or inhibitor binding. We believe our results provide valuable knowledge to understand the epidemiology of this species and to advance mechanism-based inhibitor design to add to the limited arsenal of antibiotics active against this pathogen. Stenotrophomonas maltophilia is a Gram-negative, nonfermenting, environmental bacillus that is an important cause of nosocomial infections, primarily associated with the respiratory tract in the immunocompromised population. Aiming to understand the population structure, microbiological characteristics and impact of allelic variation on β-lactamase structure and function, we collected 130 clinical isolates from across the United States. Identification of 90 different sequence types (STs), of which 63 are new allelic combinations, demonstrates the high diversity of this species. The majority of the isolates (45%) belong to genomic group 6. We also report excellent activity of the ceftazidime-avibactam and aztreonam combination, especially against strains recovered from blood and respiratory infections for which the susceptibility is higher than the susceptibility to trimethoprim-sulfamethoxazole, considered the “first-line” antibiotic to treat S. maltophilia . Analysis of 73 bla L1 and 116 bla L2 genes identified 35 and 43 novel variants of L1 and L2 β-lactamases, respectively. Investigation of the derived amino acid sequences showed that substitutions are mostly conservative and scattered throughout the protein, preferentially affecting positions that do not compromise enzyme function but that may have an impact on substrate and inhibitor binding. Interestingly, we detected a probable association between a specific type of L1 and L2 and genomic group 6. Taken together, our results provide an overview of the molecular epidemiology of S. maltophilia clinical strains from the United States. In particular, the discovery of new L1 and L2 variants warrants further study to fully understand the relationship between them and the β-lactam resistance phenotype in this pathogen. IMPORTANCE Multiple antibiotic resistance mechanisms, including two β-lactamases, L1, a metallo-β-lactamase, and L2, a class A cephalosporinase, make S. maltophilia naturally multidrug resistant. Thus, infections caused by S. maltophilia pose a big therapeutic challenge. Our study aims to understand the microbiological and molecular characteristics of S. maltophilia isolates recovered from human sources. A highlight of the resistance profile of this collection is the excellent activity of the ceftazidime-avibactam and aztreonam combination. We hope this result prompts controlled and observational studies to add clinical data on the utility and safety of this therapy. We also identify 35 and 43 novel variants of L1 and L2, respectively, some of which harbor novel substitutions that could potentially affect substrate and/or inhibitor binding. We believe our results provide valuable knowledge to understand the epidemiology of this species and to advance mechanism-based inhibitor design to add to the limited arsenal of antibiotics active against this pathogen.