Catalogue Search | MBRL
Search Results Heading
Explore the vast range of titles available.
MBRLSearchResults
-
DisciplineDiscipline
-
Is Peer ReviewedIs Peer Reviewed
-
Series TitleSeries Title
-
Reading LevelReading Level
-
YearFrom:-To:
-
More FiltersMore FiltersContent TypeItem TypeIs Full-Text AvailableSubjectCountry Of PublicationPublisherSourceTarget AudienceDonorLanguagePlace of PublicationContributorsLocation
Done
Filters
Reset
492
result(s) for
"Greco, Francesca"
Sort by:
The water we eat : combining virtual water and water footprints
by
Antonelli, Marta, editor
,
Greco, Francesca, 1978- editor
in
Water-supply Italy.
,
Food security Italy.
2015
This title pursues a comprehensive, multidisciplinary approach in order to analyse the relationship between water and food security. It demonstrates that most of the world's economies lack sufficient water resources to secure their populations' food requirements and are thus virtual importers of water.
Antiangiogenic Activity of Flavonoids: A Systematic Review and Meta-Analysis
by
Osborn, Helen M. I.
,
Khater, Mai
,
Greco, Francesca
in
Angiogenesis
,
Angiogenesis Inhibitors - chemistry
,
Angiogenesis Inhibitors - pharmacology
2020
An imbalance of angiogenesis contributes to many pathologies such as cancer, arthritis and retinopathy, hence molecules that can modulate angiogenesis are of considerable therapeutic importance. Despite many reports on the promising antiangiogenic properties of naturally occurring flavonoids, no flavonoids have progressed to the clinic for this application. This systematic review and meta-analysis therefore evaluates the antiangiogenic activities of a wide range of flavonoids and is presented in two sections. The first part of the study (Systematic overview) included 402 articles identified by searching articles published before May 2020 using ScienceDirect, PubMed and Web of Science databases. From this initial search, different classes of flavonoids with antiangiogenic activities, related pathologies and use of in vitro and/or in/ex vivo angiogenesis assays were identified. In the second part (Meta-analysis), 25 studies concerning the antiangiogenic evaluation of flavonoids using the in vivo chick chorioallantoic membrane (CAM) assay were included, following a targeted search on articles published prior to June 2020. Meta-analysis of 15 out of the 25 eligible studies showed concentration dependent antiangiogenic activity of six compared subclasses of flavonoids with isoflavones, flavonols and flavones being the most active (64 to 80% reduction of blood vessels at 100 µM). Furthermore, the key structural features required for the antiangiogenic activity of flavonoids were derived from the pooled data in a structure activity relationship (SAR) study. All in all, flavonoids are promising candidates for the development of antiangiogenic agents, however further investigations are needed to determine the key structural features responsible for their activity.
Journal Article
Influence of living settings on physical activity levels and volition in exercise in male and female university students
by
Folino, Katia
,
Cosco, Loretta Francesca
,
Facchin, Alessio
in
Adaptation, Psychological
,
Adolescent
,
Adult
2024
This study explored the influence of living settings on physical activity (PA) levels and volition in exercise and their correlation, considering sex differences. Five hundred and sixty-six university students (261 rural and 305 urban) from Calabria region (Italy) attending universities courses filled an online survey where Global Physical Activity Questionnaire and Volition in Exercise Questionnaire were administered. Rural females (RF) showed lower PA levels and self-confidence than rural males (RM) (p<0.01). Postponing training and unrelated thoughts were higher in RF than RM (p<0.01 and p<0.05 respectively). PA levels, self-confidence and coping with failure were lower in urban females (UF) than urban males (UM) (p<0.01), Postponing training and unrelated thoughts were higher in UF than UM (p<0.01 and p<0.05). In RF and UF, PA levels positively correlated with self-confidence (Rho = 0.397) and coping with failure (Rho = 0.330), whereas negatively correlated with postponing training (Rho = -0.487) and unrelated thoughts (Rho = -0.283). In RM and UM, PA levels positively correlated with self-confidence (Rho = 0.270) and coping with failure (Rho = 0.258), whereas it negatively correlated with postponing training (Rho = -0.285). PA levels positively correlated with reasons (Rho = 0.260) only in UM. We showed for the first time the relationship between PA and volition factors considering the living setting in university students. Sex differences were observed in some volition facilitators and PA levels independently by the living context.
Journal Article
The Italian breakthrough in CRISPR trials for rare diseases: a focus on beta-thalassemia and sickle cell disease treatment
by
Greco, Francesca
,
Marino, Franca
,
Cosentino, Marco
in
beta thalassaemia
,
Blood diseases
,
Cancer therapies
2024
The development of gene therapy and the current advantageous method of clustered regularly interspaced short palindromic repeats (CRISPRs) has allowed the implementation of several clinical trials aimed at studying the possible efficacy of gene therapy for rare diseases. Rare diseases pose a global challenge, in that their collective impact on health systems is considerable, whereas their individually rare occurrence hinders research and development of efficient therapies. Despite the low prevalence of individual rare diseases, there are more than 7,000 defined rare diseases affecting 3.5–5.9% of the global population. Rare diseases are mostly chronic and approximately 80% are caused by genetic mutation with an early-life onset. In Italy, in 2021 were recorded more than 400,000 people with rare disease. Because of its location and history, Italy has an unfortunate statistic regarding the presence and prevalence of two rare genetic diseases, namely beta-thalassemia, of which there are about 90 million carriers worldwide, 400,000 of whom are actually affected, and sickle cell disease, with about 300 million carriers and 6.5 million people affected worldwide. Advancements in genomic studies allowed Italy to join clinical trials to study effective and resolving gene therapies for BT and SCD. This study reports on the impact of rare diseases in Italy, ongoing studies, and recent achievements in BT and SCD trials using the CRISPR method and remaining hurdles in the application of CRISPR technology to rare diseases, also taking a glimpse at the newest challenges and future opportunities in the genetic treatment for rare diseases.
Journal Article
Effects of magnesium supplementation on muscle soreness in different type of physical activities: a systematic review
by
Folino, Katia
,
Oranges, Francesco Pio
,
Cerulli, Claudia
in
Biomedical and Life Sciences
,
Biomedicine
,
Care and treatment
2024
Background
Magnesium is a micronutrient and an intracellular cation responsible for different biochemical reactions involved in energy production and storage, control of neuronal and vasomotor activity, cardiac excitability, and muscle contraction. Magnesium deficiency may result in impaired physical performance. Moreover, magnesium plays an important role on delayed onset muscle soreness after training. Thus, physically active individuals and sport specialists have to pay attention to magnesium supplementation (MgS). However, the type, timing and dosage of magnesium intake are not well elucidated yet. Hence, we aimed to systematically review the literature regarding the effects of MgS on muscle soreness in physically active individuals. We focused exclusively on MgS, excluding those studies in which magnesium was administered together with other substances.
Methods
Three electronic databases and literature sources (PUBMED, SCOPUS and Web of Sciences-Core Collection) were searched, in accordance with PRISMA guidelines. After the database search, 1254 articles were identified, and after excluding duplicates, 960 articles remained. Among these, 955 were excluded following the title and abstract screening. The remaining 5 articles were screened in full text and 4 study met the eligibility criteria.
Results
These studies showed that MgS reduced muscle soreness, improved performance, recovery and induced a protective effect on muscle damage.
Conclusion
To reach these positive effects, individuals engaged in intense exercise should have a Mg requirement 10–20% higher than sedentary people, to be taken in capsules and 2 h before training. Moreover, it is suggested to maintain magnesium levels in the recommended range during the off-season.
Systematic review registration
PROSPERO registration number
: CRD42024501822.
Journal Article
Cognitive Impairment Predicts The Occurrence Of Hepatic Encephalopathy After Transjugular Intrahepatic Portosystemic Shunt
by
Pentassuglio, Ilaria
,
Merli, Manuela
,
Torrisi, Sabrina
in
Adult
,
Aged
,
Cognitive Dysfunction - etiology
2016
Hepatic encephalopathy (HE) is a major problem in patients treated with TIPS. The aim of the study was to establish whether pre-TIPS covert HE is an independent risk factor for the development of HE after TIPS.
Eighty-two consecutive cirrhotic patients submitted to TIPS were included. All patients underwent the PHES to identify those affected by covert HE before a TIPS. The incidence of the first episode of HE was estimated, taking into account the nature of the competing risks in the data (death or liver transplantation).
Thirty-five (43%) patients developed overt HE. The difference of post-TIPS HE was highly significant (P=0.0003) among patients with or without covert HE before a TIPS. Seventy-seven percent of patients with post-TIPS HE were classified as affected by covert HE before TIPS. Age: (sHR 1.05, CI 1.02-1.08, P=0.002); Child-Pugh score: (sHR 1.29, CI 1.06-1.56, P=0.01); and covert HE: (sHR 3.16, CI: 1.43-6.99 P=0.004) were associated with post-TIPS HE. Taking into consideration only the results of PHES evaluation, the negative predicting value was 0.80 for all patients and 0.88 for the patients submitted to TIPS because of refractory ascites. Thus, a patient with refractory ascites, without covert HE before a TIPS, has almost 90% probability of being free of HE after TIPS.
Psychometric evaluation before TIPS is able to identify most of the patients who will develop HE after a TIPS and can be used to select patients in order to have the lowest incidence of this important complication.
Journal Article
Kinetics of cytomegalovirus and Epstein-Barr virus DNA in whole blood and plasma of kidney transplant recipients: Implications on management strategies
by
Turello, Gabriele
,
Campanini, Giulia
,
Gabrielli, Liliana
in
Antiviral agents
,
Antiviral drugs
,
Automation
2020
This retrospective multicenter cohort study investigated the kinetics (ascending and descending phases) of cytomegalovirus (CMV) and Epstein-Barr virus (EBV)-DNA in whole blood (WB) and plasma samples collected from adult kidney transplant (KT) recipients. CMV-DNA kinetics according to antiviral therapy were investigated. Three hundred twenty-eight paired samples from 42 episodes of CMV infection and 157 paired samples from 26 episodes of EBV infection were analyzed by a single commercial molecular method approved by regulatory agencies for both matrices. CMV-DNAemia followed different kinetics in WB and plasma. In the descending phase of infection, a slower decay of viral load and a higher percentage of CMV-DNA positive samples were observed in plasma versus WB. In the 72.4% of patients receiving antiviral therapy, monitoring with plasma CMV-DNAemia versus WB CMV-DNAemia could delay treatment interruption by 7-14 days. Discontinuation of therapy based on WB monitoring did not result in relapsed infection in any patients. Highly different EBV-DNA kinetics in WB and plasma were observed due to lower positivity in plasma; EBV positive samples with a quantitative result in both blood compartments were observed in only 11.5% of cases. Our results emphasize the potential role of WB as specimen type for post-KT surveillance of both infections for disease prevention and management.
Journal Article
Using video reflexive ethnography to explore the use of variable rate intravenous insulin infusions
by
Crowley, Clare
,
Iedema, Rick
,
Iflaifel, Mais
in
Anthropology, Cultural
,
Blood Glucose
,
Care and treatment
2022
Background
The use of variable rate intravenous insulin infusion (VRIII) is a complex process that has consistently been implicated in reports of error and consequent harm. Investment in patient safety has focused mainly on learning from errors, though this has yet to be proved to reduce error rates. The Resilient Health Care approach advocates learning from everyday practices. Video reflexive ethnography (VRE) is an innovative methodology used to capture everyday practices, reflect on and thereby improve these. This study set out to explore the use of VRIIIs by utilising the VRE methodology.
Methods
This study was conducted in a Vascular Surgery Unit. VRE methodology was used to collect qualitative data that involved videoing healthcare practitioners caring for patients treated with VRIII and discussing the resulting clips with participants in reflexive meetings. Transcripts of these were subjected to thematic analysis. Quantitative data (e.g. blood glucose measurements) were collected from electronic patient records in order to contextualise the outcomes of the video-observed tasks.
Results
The use of VRE in conjunction with quantitative data revealed that context-dependent adaptations (seeking verbal orders to treat hypoglycaemia) and standardised practices (using VRIII guidelines) were strategies used in everyday work. Reflexive meetings highlighted the challenges faced while using VRIII, which were mainly related to lack of clinical knowledge, e.g. prescribing/continuing long-acting insulin analogues alongside the VRIII, and problems with organisational infrastructure, i.e. the wireless blood glucose meter results sometimes not updating on the electronic system. Reflexive meetings also enabled participants to share the meanings of the reality surrounding them and encouraged them to suggest solutions tailored to their work, for example face-to-face, VRIII-focused training.
Conclusions
VRE deepened understanding of VRIII by shedding light on its essential tasks and the challenges and adaptations entailed by its use. Future research might focus on collecting data across various units and hospitals to develop a full picture of the use of VRIIIs.
Journal Article
Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin
2022
Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.
Journal Article
Assistive robots for socialization in elderly people: results pertaining to the needs of the users
by
Hoshino, Hiroshi
,
Giuliani, Francesco
,
Vitanza, Alessandra
in
Caregivers
,
Geriatrics/Gerontology
,
Medicine
2019
Background/aim
Technological solutions can support the elderly, improve their quality of life and reduce isolation and loneliness. The Euro-Japan ACCRA (Agile Co-Creation for Robots and Aging) project has the objective of building a reference co-creation methodology for the development of robotic solutions for ageing. The aim of this study is to provide a pilot qualitative analysis of the real needs of elderly people and their caregivers when exposed to conversational activities with robots and to identify priority needs that should be developed from end-user perspectives.
Methods
A qualitative research design was adopted to define a pre-structured questionnaire that was administered to the elderly taking part in the piloting sessions. Three groups of end-users were included: subjects with an age ≥ 60 years, informal caregivers and formal caregivers.
Results
The interviews were carried out in Italy and Japan. A total of 17 elderly and 36 caregivers were recruited. Common needs in the two sites were categorized into 3 groups: Communication; Emotion Detection and Safety. General robot acceptance level is good and perception is positive among participants in the pilot sites.
Conclusion
A positive perception of the elderly on the application of a robotic solution was found and many are the needs that could be addressed by an appropriate and careful robotic development taking into account the real needs and capabilities of the involved subjects.
Journal Article