Catalogue Search | MBRL
Search Results Heading
Explore the vast range of titles available.
MBRLSearchResults
-
DisciplineDiscipline
-
Is Peer ReviewedIs Peer Reviewed
-
Item TypeItem Type
-
SubjectSubject
-
YearFrom:-To:
-
More FiltersMore FiltersSourceLanguage
Done
Filters
Reset
70
result(s) for
"Marasco, Daniela"
Sort by:
Self-Assembling Peptides: From Design to Biomedical Applications
by
Onesto, Valentina
,
Marasco, Daniela
,
Di Natale, Concetta
in
Amino acids
,
Drug Delivery Systems
,
Enzymes
2021
Self-assembling peptides could be considered a novel class of agents able to harvest an array of micro/nanostructures that are highly attractive in the biomedical field. By modifying their amino acid composition, it is possible to mime several biological functions; when assembled in micro/nanostructures, they can be used for a variety of purposes such as tissue regeneration and engineering or drug delivery to improve drug release and/or stability and to reduce side effects. Other significant advantages of self-assembled peptides involve their biocompatibility and their ability to efficiently target molecular recognition sites. Due to their intrinsic characteristics, self-assembled peptide micro/nanostructures are capable to load both hydrophobic and hydrophilic drugs, and they are suitable to achieve a triggered drug delivery at disease sites by inserting in their structure’s stimuli-responsive moieties. The focus of this review was to summarize the most recent and significant studies on self-assembled peptides with an emphasis on their application in the biomedical field.
Journal Article
Peptides as Therapeutic Agents for Inflammatory-Related Diseases
by
Marasco, Daniela
,
Di Natale, Concetta
,
Florio, Daniele
in
Amino Acid Sequence
,
Animals
,
Anti-Inflammatory Agents, Non-Steroidal - chemistry
2018
Inflammation is a physiological mechanism used by organisms to defend themselves against infection, restoring homeostasis in damaged tissues. It represents the starting point of several chronic diseases such as asthma, skin disorders, cancer, cardiovascular syndrome, arthritis, and neurological diseases. An increasing number of studies highlight the over-expression of inflammatory molecules such as oxidants, cytokines, chemokines, matrix metalloproteinases, and transcription factors into damaged tissues. The treatment of inflammatory disorders is usually linked to the use of unspecific small molecule drugs that can cause undesired side effects. Recently, many efforts are directed to develop alternative and more selective anti-inflammatory therapies, several of them imply the use of peptides. Indeed, peptides demonstrated as elected lead compounds toward several targets for their high specificity as well as recent and innovative synthetic strategies. Several endogenous peptides identified during inflammatory responses showed anti-inflammatory activities by inhibiting, reducing, and/or modulating the expression and activity of mediators. This review aims to discuss the potentialities and therapeutic use of peptides as anti-inflammatory agents in the treatment of different inflammation-related diseases and to explore the importance of peptide-based therapies.
Journal Article
Are peptidomimetics the compounds of choice for developing new modulators of the JAK-STAT pathway?
by
Cugudda, Alessia
,
Marasco, Daniela
,
La Manna, Sara
in
Animals
,
Atherosclerosis
,
Bioactive compounds
2024
Protein-protein interactions (PPIs) play critical roles in a wide range of biological processes including the dysregulation of cellular pathways leading to the loss of cell function, which in turn leads to diseases. The dysfunction of several signaling pathways is linked to the insurgence of pathological processes such as inflammation, cancer development and neurodegeneration. Thus, there is an urgent need for novel chemical modulators of dysregulated PPIs to drive progress in targeted therapies. Several PPIs have been targeted by bioactive compounds, and, often, to properly cover interacting protein regions and improve the biological activities of modulators, a particular focus concerns the employment of macrocycles as proteomimetics. Indeed, for their physicochemical properties, they occupy an intermediate space between small organic molecules and macromolecular proteins and are prominent in the drug discovery process. Peptide macrocycles can modulate fundamental biological mechanisms and here we will focus on peptidomimetics active on the Janus kinase/signal transducers and activators of transcription (JAK-STAT) pathways.
Journal Article
Monocytic and granulocytic myeloid derived suppressor cells differentially regulate spatiotemporal tumour plasticity during metastatic cascade
2017
It is widely accepted that dynamic and reversible tumour cell plasticity is required for metastasis, however,
in vivo
steps and molecular mechanisms are poorly elucidated. We demonstrate here that monocytic (mMDSC) and granulocytic (gMDSC) subsets of myeloid-derived suppressor cells infiltrate in the primary tumour and distant organs with different time kinetics and regulate spatiotemporal tumour plasticity. Using co-culture experiments and mouse transcriptome analyses in syngeneic mouse models, we provide evidence that tumour-infiltrated mMDSCs facilitate tumour cell dissemination from the primary site by inducing EMT/CSC phenotype. In contrast, pulmonary gMDSC infiltrates support the metastatic growth by reverting EMT/CSC phenotype and promoting tumour cell proliferation. Furthermore, lung-derived gMDSCs isolated from tumour-bearing animals enhance metastatic growth of already disseminated tumour cells. MDSC-induced ‘metastatic gene signature’ derived from murine syngeneic model predicts poor patient survival in the majority of human solid tumours. Thus spatiotemporal MDSC infiltration may have clinical implications in tumour progression.
Myeloid-derived suppressive cells (MDSCs) promote metastasis. Here, the authors show that the monocytic MDSCs subset promotes epithelial to mesenchymal transition at the primary site while the granulocytic subset promotes the reverse transition at the metastatic site enabling dynamic tumour cells plasticity.
Journal Article
Therapeutic potential of peptidomimetics of suppressors of cytokine signaling (SOCS) proteins in rheumatic disorders
2025
Dysregulation of the Janus Kinase (JAK)/Signal Transducer and Activator of Transcription (STAT) pathway is increasingly recognized as a central molecular hallmark in the pathogenesis of multiple rheumatic diseases. Suppressors of cytokine signaling (SOCS) proteins function as critical intracellular inhibitors of JAK/STAT signaling through a classical negative feedback mechanism. In Rheumatoid Arthritis (RA), aberrant upregulation of SOCS1 and SOCS3 has been documented in peripheral blood T lymphocytes, monocytes, and synovial tissues, with expression levels correlating with disease activity and progression. Notably, diminished basal expression of SOCS1 mRNA is associated with poor therapeutic response to methotrexate or rituximab, and specific SOCS1 polymorphisms have been genetically linked to RA susceptibility. In Ankylosing Spondylitis (AS), enhanced SOCS3 expression in Peripheral Blood Mononuclear Cells (PBMCs), CD4 + T cells, and monocytes show positive correlation with systemic inflammatory markers such as Erythrocyte Sedimentation Rate (ESR) and C-Reactive Protein (CRP), as well as with clinical indices of functional impairment. Conversely, SOCS1 expression is attenuated in T cells during phases of low-grade inflammation, suggesting context-dependent regulatory dynamics. In drug discovery for inflammatory diseases, recent advances have focused on the development of SOCS peptidomimetics, particularly those derived from the Kinase Inhibitory Region (KIR) of SOCS1, as novel immunomodulatory agents. These compounds have been shown to modulate hyperactive JAK/STAT signaling in autoimmune conditions. In this perspective article, we analyze current progress in the development and preclinical evaluation of mimetics of SOCS proteins and discuss their prospective role in the treatment paradigm for rheumatic disorders. Herein, we propose that peptidomimetics of SOCSs may represent a new frontier in the precise modulation of JAK/STAT signaling, offering a promising avenue toward personalized prevention and treatment of rheumatic pathologies.
Journal Article
Perspectives in Peptide-Based Vaccination Strategies for Syndrome Coronavirus 2 Pandemic
by
Marasco, Daniela
,
Di Natale, Concetta
,
De Benedictis, Ilaria
in
Amino acids
,
clinical trials
,
Coronaviridae
2020
At the end of December 2019, an epidemic form of respiratory tract infection now named COVID-19 emerged in Wuhan, China. It is caused by a newly identified viral pathogen, the severe acute respiratory syndrome coronavirus (SARS-CoV-2), which can cause severe pneumonia and acute respiratory distress syndrome. On January 30, 2020, due to the rapid spread of infection, COVID-19 was declared as a global health emergency by the World Health Organization. Coronaviruses are enveloped RNA viruses belonging to the family of Coronaviridae, which are able to infect birds, humans and other mammals. The majority of human coronavirus infections are mild although already in 2003 and in 2012, the epidemics of SARS-CoV and Middle East Respiratory Syndrome coronavirus (MERS-CoV), respectively, were characterized by a high mortality rate. In this regard, many efforts have been made to develop therapeutic strategies against human CoV infections but, unfortunately, drug candidates have shown efficacy only into in vitro studies, limiting their use against COVID-19 infection. Actually, no treatment has been approved in humans against SARS-CoV-2, and therefore there is an urgent need of a suitable vaccine to tackle this health issue. However, the puzzled scenario of biological features of the virus and its interaction with human immune response, represent a challenge for vaccine development. As expected, in hundreds of research laboratories there is a running out of breath to explore different strategies to obtain a safe and quickly spreadable vaccine; and among others, the peptide-based approach represents a turning point as peptides have demonstrated unique features of selectivity and specificity toward specific targets. Peptide-based vaccines imply the identification of different epitopes both on human cells and virus capsid and the design of peptide/peptidomimetics able to counteract the primary host-pathogen interaction, in order to induce a specific host immune response. SARS-CoV-2 immunogenic regions are mainly distributed, as well as for other coronaviruses, across structural areas such as spike, envelope, membrane or nucleocapsid proteins. Herein, we aim to highlight the molecular basis of the infection and recent peptide-based vaccines strategies to fight the COVID-19 pandemic including their delivery systems.
Journal Article
Primary tumor-induced immunity eradicates disseminated tumor cells in syngeneic mouse model
2019
Although clinically apparent metastasis is associated with late stages of cancer development, micro-metastatic dissemination may be an early event. However, the fate of these early disseminated tumor cells (DTC) remains elusive. We show that despite their capacity to disseminate into secondary organs, 4T1 tumor models develop overt metastasis while EMT6-tumor bearing mice clear DTCs shed from primary tumors as well as those introduced by intravenous (IV) injection. Following the surgical resection of primary EMT6 tumors, mice do not develop detectable metastasis and reject IV-injected tumor cells. In contrast, these cells readily grow and metastasize in immuno-deficient athymic or Rag2
−/−
mice, an effect mimicked by CD8
+
T-cell depletion in immunocompetent mice. Furthermore, recombinant G-CSF or adoptive transfer of granulocytic-MDSCs isolated from 4T1 tumor-bearing mice, induce metastasis by suppressing CD8
+
T-cells in EMT6-primed mice. Our studies support the concept of immune surveillance providing molecular insights into the immune mechanisms during tumor progression.
Dissemination of tumor cells from the primary site is an early event. Here, the authors show that the early disseminated tumor cells are actively cleared by the host cytotoxic T lymphocytes induced by the primary tumor and that infiltration of granulocytic myeloid-derived suppressor cells counteracts such immune protection and allow metastasis development.
Journal Article
Klebsiella phage KP34gp57 capsular depolymerase structure and function: from a serendipitous finding to the design of active mini-enzymes against K. pneumoniae
by
Latka, Agnieszka
,
Kramarska, Eliza
,
Drulis-Kawa, Zuzanna
in
Antibiotics
,
Antigens
,
Antimicrobial agents
2023
Virion-associated depolymerases are large trimeric and multi-domain proteins that constitute the phage arsenal to degrade the polysaccharide layers in their bacterial host. Thus, as recombinant proteins, they are endowed with huge potential in biotechnology and medicine. In this study, we elucidated the structural and functional features of the capsular depolymerase KP34gp57 from the Klebsiella phage KP34. Based on the crystal structure and site-directed mutagenesis, we localized the key catalytic residues in an intra-subunit deep groove. Moreover, we engineered several N- and C-terminally truncated versions of KP34gp57 to dissect the role of each domain in the enzyme’s stability and catalytic activity. Serendipitously, our studies revealed C-terminally trimmed KP34gp57 variants that did not trimerize and were sufficiently stable to preserve full catalytic activity as monomers. The elaboration of trimmed monomeric and fully active phage depolymerases is innovative in the field, as no previous example exists apart from bacterial enzymes. Mini phage depolymerases can be optionally combined within chimeric enzymes to extend their activity range, facilitating their use in stand-alone treatments. Moreover, the intra-subunit and inter-subunit locations of the catalytic pocket in phage depolymerases might suggest differences in their evolutionary origin. In this work, we determined the structure of Klebsiella phage KP34p57 capsular depolymerase and dissected the role of individual domains in trimerization and functional activity. The crystal structure serendipitously revealed that the enzyme can exist in a monomeric state once deprived of its C-terminal domain. Based on the crystal structure and site-directed mutagenesis, we localized the key catalytic residues in an intra-subunit deep groove. Consistently, we show that C-terminally trimmed KP34p57 variants are monomeric, stable, and fully active. The elaboration of monomeric, fully active phage depolymerases is innovative in the field, as no previous example exists. Indeed, mini phage depolymerases can be combined in chimeric enzymes to extend their activity ranges, allowing their use against multiple serotypes.
Journal Article
PEGylated SOCS3 Mimetics Encapsulated into PLGA-NPs as Selective Inhibitors of JAK/STAT Pathway in TNBC Cells
by
Netti, Paolo Antonio
,
Cugudda, Alessia
,
Mercurio, Flavia
in
Breast cancer
,
Cell Line, Tumor
,
Cytokines
2024
SOCS3 (suppressor of cytokine signaling 3) protein is a crucial regulator of cytokine-induced inflammation, and its administration has been shown to have therapeutic effects. Recently, we designed a chimeric proteomimetic of SOCS3, mimicking the interfacing regions of a ternary complex composed of SOCS3, JAK2 (Janus kinase 2) and gp130 (glycoprotein 130) proteins. The derived chimeric peptide, KIRCONG chim, demonstrated limited mimetic function owing to its poor water solubility.
We report investigations concerning a PEGylated variant of KIRCONG mimetic, named KIRCONG chim, bearing a PEG (Polyethylene glycol) moiety as a linker of noncontiguous SOCS3 regions. Its ability to bind to the catalytic domain of JAK2 was evaluated through MST (MicroScale Thermophoresis), as well as its stability in biological serum assays. The structural features of the cyclic compounds were investigated by CD (circular dichroism), nuclear magnetic resonance (NMR), and molecular dynamic (MD) studies. To evaluate the cellular effects, we employed a PLGA-nanoparticle as a delivery system after characterization using DLS and SEM techniques.
KIRCONG chim PEG-revealed selective penetration into triple-negative breast cancer (TNBC) MDA-MB-231 cells with respect to the human breast epithelial cell line (MCF10A), acting as a potent inhibitor of STAT3 phosphorylation.
Overall, the data indicated that miniaturization of the SOCS3 protein is a promising therapeutic approach for aberrant dysregulation of JAK/STAT during cancer progression.
Journal Article
Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
by
Borbone, Nicola
,
Oliviero, Giorgia
,
Falanga, Andrea Patrizia
in
Antibiotics
,
Anticancer properties
,
antineoplastic activity
2020
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.
Journal Article