Catalogue Search | MBRL
Search Results Heading
Explore the vast range of titles available.
MBRLSearchResults
-
DisciplineDiscipline
-
Is Peer ReviewedIs Peer Reviewed
-
Item TypeItem Type
-
SubjectSubject
-
YearFrom:-To:
-
More FiltersMore FiltersSourceLanguage
Done
Filters
Reset
43
result(s) for
"Marasco, Stefano"
Sort by:
Rates of Intracranial Hemorrhage in Mild Head Trauma Patients Presenting to Emergency Department and Their Management: A Comparison of Direct Oral Anticoagulant Drugs with Vitamin K Antagonists
by
Gragnaniello, Cristian
,
Del Maestro, Mattia
,
Marasco, Stefano
in
Aged
,
Aged, 80 and over
,
Anticoagulants
2020
Background and objectives: Anticoagulants are thought to increase the risks of traumatic intracranial injury and poor clinical outcomes after blunt head trauma. The safety of using direct oral anticoagulants (DOACs) compared to vitamin K antagonists (VKAs) after intracranial hemorrhage (ICH) is unclear. This study aims to compare the incidence of post-traumatic ICH following mild head injury (MHI) and to assess the need for surgery, mortality rates, emergency department (ED) revisit rates, and the volume of ICH. Materials and Methods: This is a retrospective, single-center observational study on all patients admitted to our emergency department for mild head trauma from 1 January 2016, to 31 December 2018. We enrolled 234 anticoagulated patients, of which 156 were on VKAs and 78 on DOACs. Patients underwent computed tomography (CT) scans on arrival (T0) and after 24 h (T24). The control group consisted of patients not taking anticoagulants, had no clotting disorders, and who reported an MHI in the same period. About 54% in the control group had CTs performed. Results: The anticoagulated groups were comparable in baseline parameters. Patients on VKA developed ICH more frequently than patients on DOACs and the control group at 17%, 5.13%, and 7.5%, respectively. No significant difference between the two groups was noted in terms of surgery, intrahospital mortality rates, ED revisit rates, and the volume of ICH. Conclusions: Patients with mild head trauma on DOAC therapy had a similar prevalence of ICH to that of the control group. Meanwhile, patients on VKA therapy had about twice the ICH prevalence than that on the control group or patients on DOAC, which remained after correcting for age. No significant difference in the need for surgery was determined; however, this result must take into account the very small number of patients needing surgery.
Journal Article
Subaxial Vertebral Artery Rotational Occlusion Syndrome: An Overview of Clinical Aspects, Diagnostic Work-Up, and Surgical Management
by
Gragnaniello, Cristian
,
Marasco, Stefano
,
Del Maestro, Mattia
in
Angiography
,
Ataxia
,
Case reports
2021
Extrinsic compression of the subaxial vertebral artery (VA) may cause rotational occlusion syndrome (ROS) and contribute to vertebrobasilar insufficiency potentially leading to symptoms and in severe cases, to posterior circulation strokes. The present literature review aimed to report the main clinical findings, diagnostic work-up, and surgical management of the subaxial VA-ROS, the diagnosis of which can be difficult and is often underestimated. An illustrative case is also presented. A thorough literature search was conducted to retrieve manuscripts that have discussed the etiology, diagnosis, and treatment of ROS. Total 41 articles were selected based on the best match and relevance and mainly involved case reports and small cases series. The male/female ratio and average age were 2.6 and 55.6±11 years, respectively. Dizziness, visual disturbances, and syncope were the most frequent symptoms in order of frequency, while C5 and C6 were the most affected levels. Osteophytes were the cause in >46.2% of cases. Dynamic VA catheter-based angiography was the gold standard for diagnosis along with computed tomography angiography. Except in older patients and those with prohibitive comorbidities, anterior decompressive surgery was always performed, mostly with complete recovery, and zero morbidity and mortality. A careful neurological evaluation and dynamic angiographic studies are crucial for the diagnosis of subaxial VA-ROS. Anterior decompression of the VA is the cure of this syndrome in almost all cases.
Journal Article
External Ventricular Drainage: A Practical Guide for Neuro-Anesthesiologists
by
Romenskaya, Tatsiana
,
Marasco, Stefano
,
Zanza, Christian
in
Antibiotics
,
Catheters
,
Cerebrospinal fluid
2023
External ventricular drainage is often considered a life-saving treatment in acute hydrocephalus. Given the large number of discussion points, the ideal management of EVD has not been completely clarified. The objective of this study was to review the most relevant scientific evidence about the management of EVD in its main clinical scenarios. We reviewed the most recent and relevant articles about indications, timing, management, and complications of EVD in neurocritical care, with particular interest in patients with subarachnoid hemorrhage (SAH), severe traumatic brain injury (TBI), and intraventricular hemorrhage (IVH) using the following keywords alone or matching with one another: intracranial pressure, subarachnoid hemorrhage, traumatic brain injury, intraventricular hemorrhage, external ventricular drainage, cerebrospinal shunt, intracranial pressure monitoring, and ventriculoperitoneal shunt. In the management of EVD in SAH, the intermittent drainage strategy is burdened with an elevated risk of complications (e.g., clogged catheter, hemorrhage, and need for replacement). There seems to be more ventriculoperitoneal shunt dependency in rapid weaning approach-managed patients than in those treated with the gradual weaning approach. Although there is no evidence in favor of either strategy, it is conventionally accepted to adopt a continuous drainage approach in TBI patients. Less scientific evidence is available in the literature regarding the management of EVD in patients with severe TBI and intraparenchymal/intraventricular hemorrhage. EVD placement is a necessary treatment in several clinical scenarios. However, further randomized clinical trials are needed to clarify precisely how EVD should be managed in different clinical scenarios.
Journal Article
Decompressive Craniectomy in Severe Traumatic Brain Injury: The Intensivist’s Point of View
by
Romenskaya, Tatsiana
,
Marasco, Stefano
,
Zanza, Christian
in
acute subdural hematoma
,
Blood
,
Bone mass
2023
Introduction: Traumatic brain injury (TBI) represents a severe pathology with important social and economic concerns, decompressive craniectomy (DC) represents a life-saving surgical option to treat elevated intracranial hypertension (ICP). The rationale underlying DC is to remove part of the cranial bones and open the dura mater to create space, avoiding secondary parenchymal damage and brain herniations. The scope of this narrative review is to summarize the most relevant literature and to discuss main issues about indication, timing, surgical procedure, outcome, and complications in adult patients involved in severe traumatic brain injury, underwent to the DC. The literature research is made with Medical Subject Headings (MeSH) terms on PubMed/MEDLINE from 2003 to 2022 and we reviewed the most recent and relevant articles using the following keywords alone or matched with each other: decompressive craniectomy; traumatic brain injury; intracranial hypertension; acute subdural hematoma; cranioplasty; cerebral herniation, neuro-critical care, neuro-anesthesiology. The pathogenesis of TBI involves both primary injuries that correlate directly to the external impact of the brain and skull, and secondary injuries due to molecular, chemical, and inflammatory cascade inducing further cerebral damage. The DC can be classified into primary, defined as bone flap removing without its replacement for the treatment of intracerebral mass, and secondary, which indicates for the treatment of elevated intracranial pressure (ICP), refractory to intensive medical management. Briefly, the increased brain compliance following bone removal reflects on CBF and autoregulation inducing an alteration in CSF dynamics and so, eventual complications. The risk of complications is estimated around 40%. The main cause of mortality in DC patients is due to brain swelling. In traumatic brain injury, primary or secondary decompressive craniectomy is a life-saving surgery, and the right indication should be mandatory in multidisciplinary medical–surgical consultation.
Journal Article
Rates of Intracranial Hemorrhage in Mild Head Trauma Patients Presenting to Emergency Department and Their Management: A Comparison of Direct Oral Anticoagulant Drugs with Vitamin K Antagonists
by
Gragnaniello, Cristian
,
Del Maestro, Mattia
,
Marasco, Stefano
in
Antagonists (Biochemistry)
,
Anticoagulants
,
Dosage and administration
2020
Journal Article
A Combined Baveno VII and Spleen Stiffness Algorithm to Improve the Noninvasive Diagnosis of Clinically Significant Portal Hypertension in Patients With Compensated Advanced Chronic Liver Disease
by
Renzulli, Matteo
,
Colecchia, Antonio
,
Alemanni, Luigina Vanessa
in
Algorithms
,
Ascites
,
Clinical significance
2022
INTRODUCTION:A noninvasive diagnosis of clinically significant portal hypertension (CSPH) has important prognostic and therapeutic implications for patients with compensated advanced chronic liver disease. We aimed to validate and improve the available algorithms for the CSPH diagnosis by evaluating spleen stiffness measurement (SSM) in patients with compensated advanced chronic liver disease.METHODS:This is a retrospective study including patients with liver stiffness measurement (LSM) ≥10 kPa, no previous decompensation, and available measurements of hepatic venous pressure gradient, LSM, and SSM by transient elastography referring to our center in Bologna. The diagnostic algorithms were adequate if negative and positive predictive values were >90% when ruling out and ruling in CSPH, respectively; these models were validated in a cohort from Verona. The 5-year decompensation rate was reported.RESULTS:One hundred fourteen patients were included in the derivation cohort. The Baveno VII diagnostic algorithm (LSM ≤15 kPa + platelet count ≥150 × 109/L to rule out CSPH and LSM >25 kPa to rule in CSPH) was validated; however, 40%–60% of the patients remained in the gray zone. The addition of SSM (40 kPa) to the model significantly reduced the gray zone to 7%–15%, maintaining adequate negative and positive predictive values. The diagnostic algorithms were validated in a cohort of 81 patients from Verona. All first decompensation events occurred in the “rule-in” zone of the model including SSM.DISCUSSION:The addition of SSM significantly improves the clinical applicability of the algorithm based on LSM and platelet count for CSPH diagnosis. Our models can be used to noninvasively identify candidates for nonselective beta-blocker treatment and patients at a high risk of decompensation. abstract-type=\"graphical\">
Journal Article
Tumor-Associated Macrophages and Inflammatory Microenvironment in Gastric Cancer: Novel Translational Implications
by
Rihawi, Karim
,
Ricci, Angela Dalia
,
Rizzo, Alessandro
in
Biomarkers, Tumor
,
Cancer therapies
,
Cancer-Associated Fibroblasts - immunology
2021
Gastric cancer (GC) represents the fifth most frequently diagnosed cancer worldwide, with a poor prognosis in patients with advanced disease despite many improvements in systemic treatments in the last decade. In fact, GC has shown resistance to several treatment options, and thus, notable efforts have been focused on the research and identification of novel therapeutic targets in this setting. The tumor microenvironment (TME) has emerged as a potential therapeutic target in several malignancies including GC, due to its pivotal role in cancer progression and drug resistance. Therefore, several agents and therapeutic strategies targeting the TME are currently under assessment in both preclinical and clinical studies. The present study provides an overview of available evidence of the inflammatory TME in GC, highlighting different types of tumor-associated cells and implications for future therapeutic strategies.
Journal Article
The stage of soil development modulates rhizosphere effect along a High Arctic desert chronosequence
2018
In mature soils, plant species and soil type determine the selection of root microbiota. Which of these two factors drives rhizosphere selection in barren substrates of developing desert soils has, however, not yet been established. Chronosequences of glacier forelands provide ideal natural environments to identify primary rhizosphere selection factors along the changing edaphic conditions of a developing soil. Here, we analyze changes in bacterial diversity in bulk soils and rhizospheres of a pioneer plant across a High Arctic glacier chronosequence. We show that the developmental stage of soil strongly modulates rhizosphere community assembly, even though plant-induced selection buffers the effect of changing edaphic factors. Bulk and rhizosphere soils host distinct bacterial communities that differentially vary along the chronosequence. Cation exchange capacity, exchangeable potassium, and metabolite concentration in the soil account for the rhizosphere bacterial diversity. Although the soil fraction (bulk soil and rhizosphere) explains up to 17.2% of the variation in bacterial microbiota, the soil developmental stage explains up to 47.7% of this variation. In addition, the operational taxonomic unit (OTU) co-occurrence network of the rhizosphere, whose complexity increases along the chronosequence, is loosely structured in barren compared with mature soils, corroborating our hypothesis that soil development tunes the rhizosphere effect.
Journal Article
Distinct Viral and Mutational Spectrum of Endemic Burkitt Lymphoma
by
Gazaneo, Sara
,
Marasco, Elena
,
Rocca, Bruno Jim
in
Burkitt Lymphoma - genetics
,
Burkitt Lymphoma - virology
,
Burkitt's lymphoma
2015
Endemic Burkitt lymphoma (eBL) is primarily found in children in equatorial regions and represents the first historical example of a virus-associated human malignancy. Although Epstein-Barr virus (EBV) infection and MYC translocations are hallmarks of the disease, it is unclear whether other factors may contribute to its development. We performed RNA-Seq on 20 eBL cases from Uganda and showed that the mutational and viral landscape of eBL is more complex than previously reported. First, we found the presence of other herpesviridae family members in 8 cases (40%), in particular human herpesvirus 5 and human herpesvirus 8 and confirmed their presence by immunohistochemistry in the adjacent non-neoplastic tissue. Second, we identified a distinct latency program in EBV involving lytic genes in association with TCF3 activity. Third, by comparing the eBL mutational landscape with published data on sporadic Burkitt lymphoma (sBL), we detected lower frequencies of mutations in MYC, ID3, TCF3 and TP53, and a higher frequency of mutation in ARID1A in eBL samples. Recurrent mutations in two genes not previously associated with eBL were identified in 20% of tumors: RHOA and cyclin F (CCNF). We also observed that polyviral samples showed lower numbers of somatic mutations in common altered genes in comparison to sBL specimens, suggesting dual mechanisms of transformation, mutation versus virus driven in sBL and eBL respectively.
Journal Article
Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
by
Borbone, Nicola
,
Oliviero, Giorgia
,
Falanga, Andrea Patrizia
in
Antibiotics
,
Anticancer properties
,
antineoplastic activity
2020
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.
Journal Article