Explore the vast range of titles available.

Acerola (Barbados cherries) has become a highly traded superfruit because it contains many phytonutrients and is a good source of vitamin C. The fruits of Malpighia glabra , and M. emarginata are utilized in food products, dietary supplements and natural health products. However, there are differences among the fruit of Malpighia species with respect to phytochemicals, nutrient value and clinical research. Furthermore, there is evidence of adulteration with other fruit such as cherries ( Prunus spp.). Unfortunately, conventional morphological examination does not distinguish acerola fruit species. Furthermore, no published methods are available to distinguish the fruits of these species including chemical and DNA based techniques. This risk to quality assurance (QA) is increased when considering processed berries into juice or powdered ingredients of which are the most common source for manufactures. This lack of QA methods also increases the risk of adulteration with cheaper fruit from other species. The goal of this research is to provide orthogonal molecular methods to authenticate Acerola fruit ingredients and discuss the benefits and constraints of these two different methods. This research supports quality assurance (QA) programs with fit-for-purpose methods for verifying the authenticity of acerola species ingredients from suppliers.

Metabolite fingerprint profiling is a robust tool for verifying suppliers of authentic botanical ingredients. While comparative studies exist, few apply identical conditions across multiple species; this study utilized a cross-species comparison to identify versatile solvents despite biochemical variability. Multiple solvents were used for sample extraction prior to analysis by proton NMR and liquid chromatography–mass spectrometry (LC-MS) for multiple botanicals including Camellia sinensis, Cannabis sativa, Myrciaria dubia, Sambucus nigra, Zingiber officinale, Curcuma longa, Silybum marianum, Vaccinium macrocarpon, and Prunus cerasus. Comparisons were normalized by total intensity; deuterated methanol aids NMR lock but is not required for LC-MS. Hierarchical clustering analysis (HCA) evaluated solvent efficacy. Methanol–deuterium oxide (1:1) was the most effective extraction method, yielding 155 NMR spectral metabolite variables for Camellia sinensis, while methanol (90% CH3OH + 10% CD3OD) produced 198 for Cannabis sativa and 167 for Myrciaria dubia, with 11, 9, and 28 assigned metabolites, respectively. LC-MS detected 121 metabolites in Myrciaria dubia in methanol as the most effective extraction method. Methanol (10% deuterated) is the most effective extraction method for comprehensive metabolite fingerprinting using NMR and LC-MS protocols because it provides the broadest metabolite coverage. This study advances fit-for-purpose methods to qualify suppliers of botanical ingredients in food and NHP quality control programs.

A universal barcode system for land plants would be a valuable resource, with potential utility in fields as diverse as ecology, floristics, law enforcement and industry. However, the application of plant barcoding has been constrained by a lack of consensus regarding the most variable and technically practical DNA region(s). We compared eight candidate plant barcoding regions from the plastome and one from the mitochondrial genome for how well they discriminated the monophyly of 92 species in 32 diverse genera of land plants (N = 251 samples). The plastid markers comprise portions of five coding (rpoB, rpoC1, rbcL, matK and 23S rDNA) and three non-coding (trnH-psbA, atpF-atpH, and psbK-psbI) loci. Our survey included several taxonomically complex groups, and in all cases we examined multiple populations and species. The regions differed in their ability to discriminate species, and in ease of retrieval, in terms of amplification and sequencing success. Single locus resolution ranged from 7% (23S rDNA) to 59% (trnH-psbA) of species with well-supported monophyly. Sequence recovery rates were related primarily to amplification success (85-100% for plastid loci), with matK requiring the greatest effort to achieve reasonable recovery (88% using 10 primer pairs). Several loci (matK, psbK-psbI, trnH-psbA) were problematic for generating fully bidirectional sequences. Setting aside technical issues related to amplification and sequencing, combining the more variable plastid markers provided clear benefits for resolving species, although with diminishing returns, as all combinations assessed using four to seven regions had only marginally different success rates (69-71%; values that were approached by several two- and three-region combinations). This performance plateau may indicate fundamental upper limits on the precision of species discrimination that is possible with DNA barcoding systems that include moderate numbers of plastid markers. Resolution to the contentious debate on plant barcoding should therefore involve increased attention to practical issues related to the ease of sequence recovery, global alignability, and marker redundancy in multilocus plant DNA barcoding systems.

India is rich with biodiversity, which includes a large number of endemic, rare and threatened plant species. Previous studies have used DNA barcoding to inventory species for applications in biodiversity monitoring, conservation impact assessment, monitoring of illegal trading, authentication of traded medicinal plants etc. This is the first tropical dry evergreen forest (TDEF) barcode study in the World and the first attempt to assemble a reference barcode library for the trees of India as part of a larger project initiated by this research group. We sampled 429 trees representing 143 tropical dry evergreen forest (TDEF) species, which included 16 threatened species. DNA barcoding was completed using rbcL and matK markers. The tiered approach (1st tier rbcL; 2nd tier matK) correctly identified 136 out of 143 species (95%). This high level of species resolution was largely due to the fact that the tree species were taxonomically diverse in the TDEF. Ability to resolve taxonomically diverse tree species of TDEF was comparable among the best match method, the phylogenetic method, and the characteristic attribute organization system method. We demonstrated the utility of the TDEF reference barcode library to authenticate wood samples from timber operations in the TDEF. This pilot research study will enable more comprehensive surveys of the illegal timber trade of threatened species in the TDEF. This TDEF reference barcode library also contains trees that have medicinal properties, which could be used to monitor unsustainable and indiscriminate collection of plants from the wild for their medicinal value.

Main conclusionWe identified circRNAs in the Cannabis sativa L. genome and examined their association with 28 cannabinoids in three tissues of C. sativa. Nine circRNAs are potentially involved in the biosynthesis of six cannabinoids.Cannabis sativa L. has been widely used in the production of medicine, textiles, and food for over 2500 years. The main bioactive compounds in C. sativa are cannabinoids, which have multiple important pharmacological actions. Circular RNAs (circRNAs) play essential roles in growth and development, stress resistance, and the biosynthesis of secondary metabolites. However, the circRNAs in C. sativa remain unknown. In this study, to explore the role of circRNAs in cannabinoid biosynthesis, we performed RNA-Seq and metabolomics analysis on the leaves, roots, and stems of C. sativa. We identified 741 overlapping circRNAs by three tools, of which 717, 16, and 8 circRNAs were derived from exonic, intronic, and intergenic, respectively. Functional enrichment analysis indicated that the parental genes (PGs) of circRNAs were enriched in many processes related to biological stress responses. We found that most of the circRNAs showed tissue-specific expression and 65 circRNAs were significantly correlated with their PGs (P < 0.05, |r|≥ 0.5). We also determined 28 cannabinoids by High-performance liquid chromatography-ESI-triple quadrupole-linear ion trap mass spectrometry. Ten circRNAs, including ciR0159, ciR0212, ciR0153, ciR0149, ciR0016, ciR0044, ciR0022, ciR0381, ciR0006, and ciR0025 were found to be associated with six cannabinoids by weighted gene co-expression network analysis. Twenty-nine of 53 candidate circRNAs, including 9 cannabinoids related were validated successfully using PCR amplification and Sanger sequencing. Taken together, all these results would help to enhance our acknowledge of the regulation of circRNAs, and lay the foundation for breeding new C. sativa cultivars with high cannabinoids through manipulating circRNAs.

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it’s not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species’ ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera . The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Plant-associated bacteria can establish mutualistic relationships with plants to support plant health. Plant tissues represent heterogeneous niches with distinct characteristics and may thus host distinct microbial populations. The objectives of this study are to investigate the bacterial communities associated with two medicinally and commercially important plant species; Ginkgo biloba and Panax quinquefolius using high Throughput Sequencing (HTS) of 16S rRNA gene , and to evaluate the extent of heterogeneity in bacterial communities associated with different plant niches. Alpha diversity showed that number of operational taxonomic units (OTUs) varied significantly by tissue type. Beta diversity revealed that the composition of bacterial communities varied between tissue types. In Ginkgo biloba and Panax quinquefolius, 13% and 49% of OTUs, respectively, were ubiquitous in leaf, stem and root. Proteobacteria, Bacteroidetes, Actinobacteria and Acidobacteria were the most abundant phyla in Ginkgo biloba while Proteobacteria, Bacteroidetes, Actinobacteria, Plantomycetes and Acidobacteria were the most abundant phyla in Panax quinquefolius . Functional prediction of these bacterial communities using MicrobiomeAnalyst revealed 5843 and 6251 KEGG orthologs in Ginkgo biloba and Panax quinquefolius , respectively. A number of these KEGG pathways were predicted at significantly different levels between tissues. These findings demonstrate the heterogeneity, niche specificity and functional diversity of plant-associated bacteria.

Aim Rapid and accurate species identification is the foundation for biodiversity assessment. DNA barcoding has been shown to be an effective tool to overcome the taxonomic impediment to facilitate biodiversity conservation in temperate forests. However, this tool has rarely been considered for use in tropical forests. This study aims to investigate the utility and species resolution of DNA barcoding in a subtropical region. Location The Dinghushan National Nature Reserve (DNNR) in China. Methods A DNA barcoding database was constructed for 531 trees present in the DNNR. We used a phylogenetic method (neighbour-joining trees) and sequence similarity (all-to-all BLASTn searches) to evaluate the utility and species resolution of five DNA barcode regions (rbcL, matK, ITS, ITS2 and trnH-psbA), both singly and in combinations of two or three region. Results The combination of rbcL + matK + ITS had the highest species resolution (94.19%). However, when considering the difficulty of sequence recoverability, rbcL + ITS2 performed best (64.64%). Species resolution for large genera containing more than two species was substantially lower than that for small genera with one and two species per genus. Local small spatial scales (1-ha quadrats) resulted in moderately improved species resolution (70.82% for rbcL + ITS2) compared to larger spatial scales (20 and 1133 ha). We document incongruent signals between nuclear and cpDNA regions and the challenges associated with barcoding large genera inherent to subtropical floras. Main conclusions This study considerably expands the global DNA barcode database for subtropical trees. Based on cost-effectiveness and the trade-off between sequence recovery and species resolution, we suggest that the rbcL + ITS2 barcode combination is an effective tool for documenting plant diversity in the DNNR. This study also sheds some light on the limitations and challenges for the application of barcoding to conservation biogeography in subtropical forests.

The demand for popular natural health products (NHPs) such as Black Cohosh is increasing considerably, which in turn challenges quality assurance (QA) throughout the supply chain. To detect and quantify the target species present in a given NHP, DNA-based molecular techniques such as Real-time quantitative PCR (qPCR) and digital PCR (dPCR) are standard tools in the food and pathogen testing industries. There is a gap in the literature concerning validated quantitative PCR methods for botanicals that can be utilized for QA and good manufacturing practices. The objective of this study is to develop an efficient quantification method using qPCR and dPCR techniques for the detection and quantification of Actaea racemosa (Black cohosh) NHPs from its potential adulterants. These developed methods are validated for applicability on commercial NHPs. Species-specific hydrolysis probe assays were designed to analyze the black cohosh NHPs using qPCR and dPCR techniques. The results confirmed that the developed qPCR and dPCR methods are highly precise for identifying and quantifying black cohosh NHPs, indicating their potential applicability in future routine industrial and laboratory testing. This enables a single qPCR test to determine not only the presence of a specific botanical, but also the amount when mixed with an adulterant.

Cinnamomum verum (syn C. zeylanicum) is considered ‘true’ cinnamon. However, it is reported that less expensive sources of cinnamon from C. cassia (syn C. aromaticum), C. loureiroi, and C. burmannii (toxic coumarin) may be used in the place of C. verum. We lack the quality assurance tools that are required to differentiate C. verum from other cinnamon species when verifying that the correct species is sourced from ingredient suppliers. The current research on cinnamon species authentication using DNA tools is limited to a few species and the use of high-quality DNA extracted from raw leaf materials. The cinnamon bark traded in the supply chain contains much less DNA and poorer-quality DNA than leaves. Our research advances DNA methods to authenticate cinnamon, as we utilized full-length chloroplast genomes via a genome skimming approach for C. burmannii and C. cassia to facilitate the design of optimal mini DNA markers. Furthermore, we developed and validated the use of NMR fingerprints for several commercial cinnamon species, including the quantification of 16 molecules. NMR fingerprints provided additional data that were useful for quality assessment in cinnamon extract powders and product consistency. Both the new mini DNA markers and NMR fingerprints were tested on commercial cinnamon products.