Explore the vast range of titles available.

This review summarizes the leading advancements in porous silicon (PSi) optical-biosensors, achieved over the past five years. The cost-effective fabrication process, the high internal surface area, the tunable pore size, and the photonic properties made the PSi an appealing transducing substrate for biosensing purposes, with applications in different research fields. Different optical PSi biosensors are reviewed and classified into four classes, based on the different biorecognition elements immobilized on the surface of the transducing material. The PL signal modulation and the effective refractive index changes of the porous matrix are the main optical transduction mechanisms discussed herein. The approaches that are commonly employed to chemically stabilize and functionalize the PSi surface are described.

Diatom microalgae are the most outstanding natural source of porous silica. The diatom cell is enclosed in a three-dimensional (3-D) ordered nanopatterned silica cell wall, called frustule. The unique properties of the diatom frustule, including high specific surface area, thermal stability, biocompatibility, and tailorable surface chemistry, make diatoms really promising for biomedical applications. Moreover, they are easy to cultivate in an artificial environment and there is a large availability of diatom frustules as fossil material (diatomite) in several areas of the world. For all these reasons, diatoms are an intriguing alternative to synthetic materials for the development of low-cost drug delivery systems. This review article focuses on the possible use of diatom-derived silica as drug carrier systems. The functionalization strategies of diatom micro/nanoparticles for improving their biophysical properties, such as cellular internalization and drug loading/release kinetics, are described. In addition, the realization of hybrid diatom-based devices with advanced properties for theranostics and targeted or augmented drug delivery applications is also discussed.

Diatoms—unicellular photosynthetic algae—are promising natural sources of nanostructured silica. These microorganisms produce in their membrane approximately a highly ordered porous cell wall called a frustule as protection from environmental stress. Diatom frustules consist of hydrated silica that show peculiar properties including biocompatibility, tailorable surface chemistry, chemical inertness, and thermal stability. Frustules harvested from aquatic ecosystems or diatomaceous fossil sediments represent an excellent cost-effective source of biosilica for a broad range of biomedical applications. The porous ultrastructure of the frustules displays a large surface area available for coating with various biomolecules through different functionalization methods. In this review article, we highlight the main features of diatom biosilica and present some of the most advantageous properties that support the employment of frustules in the field of drug delivery, biosensing, and regenerative medicine. In particular, it is offered an insight into the most common functionalization strategies through which diatom physicochemical properties can be modified and tailored according to the described field of application.

As a part of an SAR study aimed at testing the antitumor activity of some C15 acetogenins related to mycalin A, we report here the synthesis of the C-1 debromo-derivative of laurenciallene, a substance recently isolated from the red alga Laurencia obtusa. This new substance has been obtained by the selective, reductive debromination of the terminal bromoallene moiety of laurenciallene with Zn/AcOH. Its structure has been fully characterized by spectral methods, including 2D-NMR spectra.

Aptamers are artificial nucleic acid ligands identified and obtained from combinatorial libraries of synthetic nucleic acids through the in vitro process SELEX (systematic evolution of ligands by exponential enrichment). Aptamers are able to bind an ample range of non-nucleic acid targets with great specificity and affinity. Devices based on aptamers as bio-recognition elements open up a new generation of biosensors called aptasensors. This review focuses on some recent achievements in the design of advanced label-free optical aptasensors using porous silicon (PSi) as a transducer surface for the detection of pathogenic microorganisms and diagnostic molecules with high sensitivity, reliability and low limit of detection (LoD).

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Starting from D-xylonolactone and D-ribonolactone, several five-membered bromolactones, related to the C1–C5 portion of mycalin A lactone, have been synthesized. The bromination of D-ribonolactone with HBr/AcOH, without a subsequent transesterification step, has been studied for the first time, giving us most of the acetylated lactones investigated in the present study. For each compound, where possible, both the C-3 alcohol and the corresponding acetate were prepared. Evaluation of their anti-tumor activity showed that all the acetates possess a good cytotoxicity towards human melanoma (A375), human cervical adenocarcinoma (HeLa) and human metastatic melanoma (WM266) cancer cells, comparable or even higher than that displayed by the original mycalin A lactone. Lactone acetates derived from D-ribonolactone showed the higher selectivity of action, exhibiting a strong cytotoxicity on all the tested tumor cells but only a limited toxicity on healthy human dermal fibroblast (HDF) cells, used as a control. Wound healing assays showed that two of these substances inhibit the migration of the WM266 cells.

G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies. Herein, we describe some G4 structures found in plants, summarizing the existing knowledge of their functions and biological role. Moreover, we review some of the most promising G4 ligands isolated from vegetal sources and report on the known relationships between such phytochemicals and G4-mediated biological processes that make them potential leads in the pharmaceutical sector.

Mycalin A, a polybrominated C15 acetogenin isolated from the encrusting sponge Mycale rotalis, displays an antiproliferative activity on human melanoma (A375) and cervical adenocarcinoma (HeLa) cells and induces cell death by an apoptotic mechanism. Various analogues and degraded derivatives of the natural substance have been prepared. A modification of the left-hand part of the molecule generates the most active substances. A structurally simplified lactone derivative of mycalin A, lacking the C1–C3 side chain, is the most active among the synthesized compounds exhibiting a strong cytotoxicity on both A375 and HeLa cells but not but not on human dermal fibroblast (HDF) used as healthy cells. Further evidence on a recently discovered chlorochromateperiodate-catalyzed process, used to oxidise mycalin A, have been collected.

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1′-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin–West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δβ-turn + Δβ-sheet = +23.6%, Δα = −16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14−1 (HDOCK score (top 1–3 poses): −157.11 ± 1.38 (U2O); −129.80 ± 6.92 (HA 14−1); binding energy: −7.6 kcal/mol (U2O); −5.9 kcal/mol (HA 14−1)) and T2O (HDOCK score (top 1–3 poses): −149.93 ± 2.35; binding energy: −7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1′-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the β-structure are consistent with a partial protein destabilization due to the interaction with U2O.