Explore the vast range of titles available.

Reproduction is a vital component in the animal husbandry practices. Infertility is a significant concern in domestic animals, as it can impact breeding programs, animal productivity, and the overall health of animal populations. Infertility in domestic animals refers to the inability of an animal to reproduce successfully, either by conceiving, carrying a pregnancy to term, or giving birth to healthy offspring. It can also affect various species of domestic animals, including cattle, horses, sheep, goats, pigs, dogs, cats, and more. It is a significant concern for animal breeders, farmers, pet owners, and veterinarians, as it can have economic, emotional, and practical implications. Infertility can have various causes, including genetic, anatomical abnormalities, age, physiological, endocrine disruptions, nutrition, infections and diseases, environmental, and management factors. Some animals may inherit genetic traits that can lead to reproductive problems, such as structural abnormalities or hormonal imbalances that affect their fertility. Physical abnormalities in the reproductive tract, such as uterine malformations or blocked fallopian tubes, can prevent successful conception and pregnancy. The age of the animal can impact fertility. Older animals might experience reduced reproductive capacity due to changes in hormonal balance and overall health. In females, conditions such as ovarian cysts, uterine infections, and blocked fallopian tubes can lead to infertility. In males, problems like low sperm count, poor sperm motility, and anatomical abnormalities can contribute to infertility. Hormonal disorders, like those affecting the thyroid or reproductive hormones, can disrupt normal reproductive cycles and processes. Exposure to endocrine-disrupting substances, like certain pesticides or pollutants, can interfere with hormonal regulation and reproductive function. Inadequate or imbalanced nutrition can impact an animal's reproductive health. Both under nutrition and excess nutrition can lead to fertility issues. Certain infections, such as sexually transmitted diseases or reproductive tract infections can directly affect reproductive organs or disrupt hormonal balance, leading to infertility. Environmental conditions can have a significant impact on reproductive success. Stress, extreme temperatures, poor housing conditions, and exposure to certain chemicals or toxins can negatively affect fertility. Improper breeding practices, such as overbreeding, or inadequate timing of mating or AI, can lead to reduced fertility. Infertility diagnosis in domestic animals involves a combination of physical examinations, clinical evaluation, reproductive history, and various diagnostic tests, such as hormone level assessments, ultrasound imaging of reproductive organs, and semen analysis in males. Veterinarians will work to identify the underlying cause of infertility in order to develop an appropriate treatment and management strategies. An infertility management strategy involves maintaining optimal reproductive health through balanced ration, suitable housing, disease prevention measures, and stress reduction. Judicious hormonal therapies, surgical interventions, implementing proper breeding practices, and assisted reproductive techniques like artificial insemination or in vitro fertilization can be employed to address specific issues. In conclusion, infertility in domestic animals can have a substantial impact on agricultural productivity and breeding programs. It's important to note that infertility can be a multifaceted problem, often requiring an understanding of the causes, along with appropriate management, veterinary care, and, in some cases, advanced reproductive technologies. Addressing infertility requires focusing on the health and well-being of domestic animals, we can mitigate the challenges posed by infertility and ensure the sustainability of livestock production and companion animal populations.

Hybridization is important for both animal breeders attempting to fix new phenotypic traits and researchers trying to unravel the mechanism of reproductive barriers in hybrid species and the process of speciation. In interspecies animal hybrids, gains made in terms of adaptation to environmental conditions and hybrid vigor may be offset by reduced fertility or sterility. Bovine hybrids exhibit remarkable hybrid vigor compared to their parents. However, the F1 male hybrid exhibits sterility, whereas the female is fertile. This male-biased sterility is consistent with the Haldane rule where heterogametic sex is preferentially rare, absent, or sterile in the progeny of two different species. The obstacle of fixing favorable traits and passing them to subsequent generations due to the male sterility is a major setback in improving the reproductive potential of bovines through hybridization. Multiperspective approaches such as molecular genetics, proteomics, transcriptomics, physiology, and endocrinology have been used by several researchers over the past decade in an attempt to unravel the potential mechanisms underlying male hybrid sterility. However, the mechanism of sterility in the hybrid male is still not completely unravelled. This review seeks to provide an update of the mechanisms of the sterility in the cattle-yak and other bovines. Summary sentence Bovine hybrids exhibit obvious hybrid vigor over either parent but while the F1 female is fertile, the male exhibits sterility. This prohibits the utilization of the hybrid vigor hence poses a challenge to the improvement of local species through hybridization.

CRISPR-based gene drives offer promising prospects for controlling disease-transmitting vectors and agricultural pests. A significant challenge for successful suppression-type drive is the rapid evolution of resistance alleles. One approach to mitigate the development of resistance involves targeting functionally constrained regions using multiple gRNAs. In this study, we constructed a 3-gRNA homing gene drive system targeting the recessive female fertility gene Tyrosine decarboxylase 2 ( Tdc2 ) in Drosophila suzukii , a notorious fruit pest. Our investigation revealed only a low level of homing in the germline, but feeding octopamine restored the egg-laying defects in Tdc2 mutant females, allowing easier line maintenance than for other suppression drive targets. We tested the effectiveness of a similar system in Drosophila melanogaster and constructed additional split drive systems by introducing promoter-Cas9 transgenes to improve homing efficiency. Our findings show that genetic polymorphisms in wild populations may limit the spread of gene drive alleles, and the position effect profoundly influences Cas9 activity. Furthermore, this study highlights the potential of conditionally rescuing the female infertility caused by the gene drive, offering a valuable tool for the industrial-scale production of gene drive transgenic insects.

Looks at how New Zealand is reportedly considering gene drive technology as a way to locally eliminate the mammalian pests that threaten its unique flora and fauna. Explores the risk of accidental spread posed by self-propagating gene drive technologies . Highlights new gene drive designs that might achieve better outcomes. Explains why open and international discussions are needed concerning a technology that could have global ramifications. Mentions Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) genome editing. Source: National Library of New Zealand Te Puna Matauranga o Aotearoa, licensed by the Department of Internal Affairs for re-use under the Creative Commons Attribution 3.0 New Zealand Licence.

Spodoptera litura (Fabr.) is a serious noctuid lepidopteran pest in India that can be managed using the eco-friendly, radio-genetic inherited sterility (IS) technique. Improving the quality of laboratory-reared moths might increase the efficacy of released sterile moths using this technique. In the present study, radiation hormesis using low-dose ionizing radiation administered to different ontogenetic stages was studied. The growth potential and survival of the developing stages derived from these treated stages was assessed, followed by an assessment of the expression profile of longevity- and viability-related genes. The findings indicated that ionizing radiation doses of 0.75–1.0 Gy might be used as hormetic treatments in eggs, larvae, or the pupal stages of S. litura. This would result in more viable and competitive adult moths for use in the IS technique. Mass rearing of insects of high biological quality is a crucial attribute for the successful implementation of sterile insect release programs. Various ontogenetic stages of Spodoptera litura (Fabr.) were treated with a range of low doses of ionizing radiation (0.25–1.25 Gy) to assess whether these gamma doses could elicit a stimulating effect on the growth and viability of developing moths. Doses in the range of 0.75 Gy to 1.0 Gy administered to eggs positively influenced pupal weight, adult emergence, and growth index, with a faster developmental period. The enhanced longevity of adults derived from eggs treated with 0.75 Gy and 1.0 Gy, and for larvae and pupae treated with 1.0 Gy, indicated a hormetic effect on these life stages. Furthermore, the use of these hormetic doses upregulated the relative mRNA expression of genes associated with longevity (foxo, sirtuin 2 like/sirt1, atg8) and viability/antioxidative function (cat and sod), suggesting a positive hormetic effect at the transcriptional level. These results indicated the potential use of low dose irradiation (0.75–1 Gy) on preimaginal stages as hormetic doses to improve the quality of the reared moths. This might increase the efficiency of the inherited sterility technique for the management of these lepidopteran pests.

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1.

Background: Inbreeding is a major genetic problem that reduces fertility and causes genetic disorders. Some breeders of dromedary camels use the same bull for many years due to its excellent characteristics, leading to mating with offspring and subsequent generations, resulting in increased homozygosity and genetic disorders. We hypothesize that inbreeding is associated with infertility in dromedary camels with normal and uninfected reproductive tracts. Methods: We genotyped 96 samples from seven camel breeds using the Illumina 55K SNP BeadChip, including five confirmed infertile individuals. Inbreeding coefficients (F) were calculated using PLINK based on heterozygosity and runs of homozygosity. Genome-wide association analysis using logistic regression was performed to identify potential genomic regions associated with infertility. Results: All five infertile camels showed significantly higher F values (>0.15) compared to 91 fertile individuals (<0.10, p < 0.001). The genome-wide association analysis failed to identify specific genomic regions linked to infertility, likely due to limited statistical power (n = 5 cases) and the polygenic nature of fertility traits. Population structure analysis revealed genetic differentiation related to coat color, with two significant SNPs on chromosome 3 near SLC30A5 (p < 10−7). Conclusions: Our results demonstrate that elevated inbreeding is strongly associated with infertility in dromedary camels. Future studies should employ larger sample sizes (≥50 infertile individuals) or whole-genome sequencing (35× coverage) to identify specific genomic regions. Implementation of breeding strategies avoiding related matings (F < 0.10) is recommended to maintain reproductive performance in camel herds.

This review paper delves into the intricate relationship between the genital microbiome and fertility outcomes in livestock, with a specific focus on cattle. Drawing upon insights derived from culture-independent metagenomics studies, the paper meticulously examines the composition and dynamics of the genital microbiome. Through advanced techniques such as high-throughput sequencing, the review illuminates the temporal shifts in microbial communities and their profound implications for reproductive health. The analysis underscores the association between dysbiosis—an imbalance in microbial communities—and the development of reproductive diseases, shedding light on the pivotal role of microbial gatekeepers in livestock fertility. Furthermore, the paper emphasizes the need for continued exploration of uncharted dimensions of the female reproductive microbiome to unlock new insights into its impact on fertility. By elucidating the complex interplay between microbial communities and reproductive health, this review underscores the importance of innovative strategies aimed at enhancing fertility and mitigating reproductive diseases in livestock populations.

Babies are not simply born-they are made through cultural and social practices. Based on rich empirical work, this book examines the everyday experiences that mark pregnancy in the US today, such as reading pregnancy advice books, showing ultrasound \"baby pictures\" to friends and co-workers, and decorating the nursery in anticipation of the new arrival. These ordinary practices of pregnancy, the author argues, are significant and revealing creative activities that produce babies. They are the activities through which babies are made important and meaningful in the lives of the women and men awaiting the child's birth. This book brings into focus a topic that has been overlooked in the scholarship on reproduction and will be of interest to professionals and expectant parents alike.

The mosquito Aedes albopictus can transmit various arboviral diseases, posing a severe threat to human health. As an environmentally friendly method, sterile insect technology (SIT) is considered an alternative to traditional methods such as chemical pesticides to control Ae. albopictus. In SIT, the sterility of male mosquitoes can be achieved by γ-ray or X-ray radiation. Compared with γ-rays, X-rays are easier to obtain, cheaper, and less harmful. However, there is a lack of comparative assessment of these two types of radiation for SIT under the same controlled conditions. Here, we compared the effects of X-ray and γ-ray radiation on the sterility of Ae. albopictus males under laboratory-controlled conditions. Neither type of radiation affected the number of eggs but significantly reduced the survival time and hatch rate. The same dose of γ-rays caused a higher sterility effect on males than X-rays but had a more significant impact on survival. However, X-rays could achieve the same sterility effect as γ-rays by increasing the radiation dose. For example, X-rays of 60 Gy induced 99% sterility, similar to γ-rays of 40 Gy. In the test of male mating competitiveness, the induced sterility and the male mating competitiveness index were also identical at the same release ratio (sterile males/fertile males). At a release ratio of 7:1, nearly 80% of eggs failed to hatch. Sterile males produced by X-ray and γ-ray radiation had similar male competitiveness in competition with field males. In conclusion, a higher dose of X-rays is required to achieve the same sterility effect, compared to γ-rays. When γ-rays are not readily available, high-dose X-rays can be used instead. This study provides data supporting the selection of more suitable radiation for the field release of sterile male mosquitoes.