Catalogue Search | MBRL
Search Results Heading
Explore the vast range of titles available.
MBRLSearchResults
-
DisciplineDiscipline
-
Is Peer ReviewedIs Peer Reviewed
-
Item TypeItem Type
-
SubjectSubject
-
YearFrom:-To:
-
More FiltersMore FiltersSourceLanguage
Done
Filters
Reset
948
result(s) for
"L-lysine"
Sort by:
Epsilon-poly-L-lysine: Recent Advances in Biomanufacturing and Applications
by
Chen, Xusheng
,
Zhang, Chongyang
,
Xu, Xueming
in
Amino acids
,
Antimicrobial activity
,
antimicrobial property
2021
ε-poly-L-lysine (ε-PL) is a naturally occurring poly(amino acid) of varying polymerization degree, which possesses excellent antimicrobial activity and has been widely used in food and pharmaceutical industries. To provide new perspectives from recent advances, this review compares several conventional and advanced strategies for the discovery of wild strains and development of high-producing strains, including isolation and culture-based traditional methods as well as genome mining and directed evolution. We also summarize process engineering approaches for improving production, including optimization of environmental conditions and utilization of industrial waste. Then, efficient downstream purification methods are described, including their drawbacks, followed by the brief introductions of proposed antimicrobial mechanisms of ε-PL and its recent applications. Finally, we discuss persistent challenges and future perspectives for the commercialization of ε-PL.
Journal Article
Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
by
Borbone, Nicola
,
Oliviero, Giorgia
,
Falanga, Andrea Patrizia
in
Antibiotics
,
Anticancer properties
,
antineoplastic activity
2020
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.
Journal Article
A rapid method for isolation of bacterial extracellular vesicles from culture media using epsilon-poly-L–lysine that enables immunological function research
by
Xing, Wanli
,
Jiao, Dian
,
Wei, Shujin
in
Antimicrobial agents
,
bacterial culture medium
,
bacterial extracellular vesicles
2022
Both Gram-negative and Gram-positive bacteria can release vesicle-like structures referred to as bacterial extracellular vesicles (BEVs), which contain various bioactive compounds. BEVs play important roles in the microbial community interactions and host-microbe interactions. Markedly, BEVs can be delivered to host cells, thus modulating the development and function of the innate immune system. To clarify the compositions and biological functions of BEVs, we need to collect these vesicles with high purity and bioactivity. Here we propose an isolation strategy based on a broad-spectrum antimicrobial epsilon-poly-L-lysine (ϵ-PL) to precipitate BEVs at a relatively low centrifugal speed (10,000 × g). Compared to the standard ultracentrifugation strategy, our method can enrich BEVs from large volumes of media inexpensively and rapidly. The precipitated BEVs can be recovered by adjusting the pH and ionic strength of the media, followed by an ultrafiltration step to remove ϵ-PL and achieve buffer exchange. The morphology, size, and protein composition of the ϵ-PL-precipitated BEVs are comparable to those purified by ultracentrifugation. Moreover, ϵ-PL-precipitated BEVs retained the biological activity as observed by confocal microscopy studies. And THP-1 cells stimulated with these BEVs undergo marked reprogramming of their transcriptome. KEGG analysis of the differentially expressed genes showed that the signal pathways of cellular inflammatory response were significantly activated. Taken together, we provide a new method to rapidly enrich BEVs with high purity and bioactivity, which has the potential to be applied to BEVs-related immune response studies.
Journal Article
Effects of Decomplexation Rates on Ternary Gene Complex Transfection with α-Poly(l-Lysine) or ε-Poly(l-Lysine) as a Decomplexation Controller in An Easy-To-Transfect Cell or A Hard-To-Transfect Cell
by
Cho, Yong-Yeon
,
Shim, Min Suk
,
Lee, Joo Young
in
decomplexation
,
nuclear uptake
,
pDNA release
2020
The tight binding of pDNA with a cationic polymer is the crucial requirement that prevents DNA degradation from undesired DNase attack to safely deliver the pDNA to its target site. However, cationic polymer-mediated strong gene holding limits pDNA dissociation from the gene complex, resulting in a reduction in transfection efficiency. In this study, to control the decomplexation rate of pDNA from the gene complex in a hard-to-transfect cell or an easy-to-transfect cell, either α-poly(l-lysine) (APL) or ε-poly(l-lysine) (EPL) was incorporated into branched polyethylenimine (bPEI)-based nanocomplexes (NCs). Compared to bPEI/pDNA NCs, the addition of APL or EPL formed smaller bPEI-APL/pDNA NCs with similar zeta potentials or larger bPEI-EPL/pDNA NCs with reduced zeta potentials, respectively, due to the different characteristics of the primary amines in the two poly(l-lysine)s (PLs). Interestingly, although both bPEI-APL/pDNA NCs and bPEI-EPL/pDNA NCs showed similar pDNA compactness to bPEI/pDNA NCs, the addition of APL or EPL resulted in slower or faster pDNA release, respectively, from the bPEI-PL/pDNA NCs than from the bPEI/pDNA NCs. bPEI-EPL/pDNA NCs with a decomplexation enhancer (i.e., EPL) improved the transfection efficiency (TE) in both a hard-to-transfect HepG2 cell and an easy-to-transfect HEK293 cell. However, although a decomplexation inhibitor (i.e., APL) reduced the TE of bPEI-APL/pDNA NCs in both cells, the degree of reduction in the TE could be compensated by PL-mediated enhanced nuclear delivery, particularly in HepG2 cells but not HEK293 cells, because both PLs facilitate nuclear localization of the gene complex per its cellular uptake. In conclusion, a decomplexation rate controller could be a potential factor to establish a high TE and design clinically available gene complex systems.
Journal Article
Engineering Streptomyces albulus to enhance ε-poly-L-lysine production by introducing a polyphosphate kinase-mediated ATP regeneration system
by
Chen, Xusheng
,
Yang, Hao
,
Zhang, Jianhua
in
Adenosine diphosphate
,
Adenosine Triphosphate
,
Aerobic bacteria
2023
Background
ε-Poly-L-lysine (ε-PL) is a natural and safe food preservative that is mainly produced by filamentous and aerobic bacteria
Streptomyces albulus
. During ε-PL biosynthesis, a large amount of ATP is used for the polymerization of L-lysine. A shortage of intracellular ATP is one of the major factors limiting the increase in ε-PL production. In previous studies, researchers have mainly tried to increase the oxygen supply to enhance intracellular ATP levels to improve ε-PL production, which can be achieved through the use of two-stage dissolved oxygen control, oxygen carriers, heterologous expression of hemoglobin, and supplementation with auxiliary energy substrates. However, the enhancement of the intracellular ATP supply by constructing an ATP regeneration system has not yet been considered.
Results
In this study, a polyphosphate kinase (PPK)-mediated ATP regeneration system was developed and introduced into
S. albulus
to successfully improve ε-PL production. First, polyP:AMP phosphotransferase (PAP) from
Acinetobacter johnsonii
was selected for catalyzing the conversion of AMP into ADP through an in vivo test. Moreover, three PPKs from different microbes were compared by in vitro and in vivo studies with respect to catalytic activity and polyphosphate (polyP) preference, and PPK2B
cg
from
Corynebacterium glutamicum
was used for catalyzing the conversion of ADP into ATP. As a result, a recombinant strain PL05 carrying coexpressed
pap
and
ppk2B
cg
for catalyzing the conversion of AMP into ATP was constructed. ε-PL production of 2.34 g/L was achieved in shake-flask fermentation, which was an increase of 21.24% compared with
S. albulus
WG608; intracellular ATP was also increased by 71.56%. In addition, we attempted to develop a dynamic ATP regulation route, but the result was not as expected. Finally, the conditions of polyP
6
addition were optimized in batch and fed-batch fermentations, and the maximum ε-PL production of strain PL05 in a 5-L fermenter was 59.25 g/L by fed-batch fermentation, which is the highest ε-PL production reported in genetically engineered strains.
Conclusions
In this study, we proposed and developed a PPK-mediated ATP regeneration system in
S. albulus
for the first time and significantly enhanced ε-PL production. The study provides an efficient approach to improve the production of not only ε-PL but also other ATP-driven metabolites.
Journal Article
The antimicrobial effects and mechanism of ε-poly-lysine against Staphylococcus aureus
2019
BackgroundAs a natural antibacterial cationic peptide, ε-poly-l-lysine (ε-PL) is applied as a food preservative. However, the mechanism of ε-PL against Staphylococcus aureus (S. aureus) has not been elucidated. Especially, its antimicrobial mechanism at the metabolomics has not been yet thoroughly described.ResultsThis work aimed at clarifying the antibacterial activity and mechanism of ε-PL against S. aureus. Effects of ε-PL with different concentration on cell morphology, cell wall, and membrane integrity were investigated. Furthermore, the effect of ε-PL on metabolite properties of S. aureus was also studied. The results revealed that ε-PL disrupted the cell wall and membrane integrity of treated cells. ε-PL induced the structural change of peptidoglycan in cell wall, causing cell wall more fragile. Meanwhile, the permeability of the S. aureus cell membrane was increased by ε-PL. More importantly, ε-PL with different concentration could cause different effects on metabolic pathways of S. aureus. ε-PL with high concentration could directly restrain the central carbon metabolism. However, ε-PL with low concentration could only inhibit the glycolytic pathway.ConclusionThese results showed that the antimicrobial mechanism of ε-PL against S. aureus was a synergistic action.
Journal Article
Enhanced endosomal escape of dendrigraft poly-L-lysine polymers for the efficient gene therapy of breast cancer
by
Chen, Xiaojing
,
Zhao, Xue
,
Liu, Peifeng
in
Atomic/Molecular Structure and Spectra
,
Biomedicine
,
Biotechnology
2022
Dendrimer, such as dendrigraft poly-L-lysine (DGL) polymers, with high surface charge density, well-defined structure, and narrow poly-dispersity is often employed as a gene vector, but its transfection efficiency is still partially inhibited due to poor endosomal escape ability. Herein, we used a surface modification strategy to enhance the endosomal escape ability of DGL polymers, and thus improved its gene transfection efficiency. A library of phenylboronic acid (PBA) modified DGL polymers (PBA-DGLs) was designed to screen efficient small interfering RNA (siRNA) vectors. The lead candidate screened from the library shown a capability of inducing nearly 90% gene silencing in MDA-MB-231 cells. The study of the transfection mechanism revealed that PBA modification not only improves siRNA cellular uptake, but, more importantly, endows DGL polymers the ability of endosomal escape. One of the top candidates from polyplexes was further shielded with hyaluronic acid to construct targeted nanoparticles, and the yielding nanoparticles significantly suppressed the tumor growth in a breast cancer model by effective siRNA delivery. This research provides a general and effective strategy to enhance the endosomal escape and transfection efficiency of dendrimer.
Journal Article
ε-Poly-l-Lysine Enhances Fruit Disease Resistance in Postharvest Longans (Dimocarpus longan Lour.) by Modulating Energy Status and ATPase Activity
by
Hung, Yen-Con
,
Jiang, Yuji
,
Chen, Hongbin
in
Adenosine diphosphate
,
Adenosine monophosphate
,
Adenosine triphosphatase
2022
ε-poly-l-lysine (ε-PL) holds a strong antibacterial property and is widely used for food preservation. However, the application of ε-PL to enhance fruit disease resistance in postharvest longans (Dimocarpus longan Lour.) has not been explored. The objective of this study was to explore the impact of ε-PL treatment on disease occurrence and energy metabolism of longans infected with Phomopsis longanae Chi (P. longanae). It was found that, in comparison with P. longanae-inoculated longans, ε-PL could decrease the fruit disease index and adenosine monophosphate (AMP) content, increase the amounts of adenosine triphosphate (ATP), adenosine diphosphate (ADP), and energy charge, and enhance the activities of adenosine triphosphatase (ATPase) (such as H+-, Mg2+-, and Ca2+-ATPase) in the mitochondria, protoplasm, and vacuole. The results suggest that the higher levels of ATPase activity and energy status played essential roles in disease resistance of postharvest longan fruit. Therefore, the ε-PL treatment can be used as a safe and efficient postharvest method to inhibit the disease occurrence of longan fruit during storage at room temperature.
Journal Article
Efficient and scalable synthesis of 1,5-diamino-2-hydroxy-pentane from l-lysine via cascade catalysis using engineered Escherichia coli
by
Hu, Shewei
,
Zhang, Alei
,
Li, Yangyang
in
(2S, 3S)-3-hydroxylysine
,
1,5-diamino-2-hydroxy-pentane
,
Alcohol
2022
Background
1,5-Diamino-2-hydroxy-pentane (2-OH-PDA), as a new type of aliphatic amino alcohol, has potential applications in the pharmaceutical, chemical, and materials industries. Currently, 2-OH-PDA production has only been realized via pure enzyme catalysis from lysine hydroxylation and decarboxylation, which faces great challenges for scale-up production. However, the use of a cell factory is very promising for the production of 2-OH-PDA for industrial applications, but the substrate transport rate, appropriate catalytic environment (pH, temperature, ions) and separation method restrict its efficient synthesis. Here, a strategy was developed to produce 2-OH-PDA via an efficient, green and sustainable biosynthetic method on an industrial scale.
Results
In this study, an approach was created for efficient 2-OH-PDA production from
l
-lysine using engineered
E. coli
BL21 (DE3) cell catalysis by a two-stage hydroxylation and decarboxylation process. In the hydroxylation stage, strain B14 coexpressing
l
-lysine 3-hydroxylase K3H and the lysine transporter CadB-argT enhanced the biosynthesis of (2S,3S)-3-hydroxylysine (hydroxylysine) compared with strain B1 overexpressing K3H. The titre of hydroxylysine synthesized by B14 was 2.1 times higher than that synthesized by B1. Then, in the decarboxylation stage, CadA showed the highest hydroxylysine activity among the four decarboxylases investigated. Based on the results from three feeding strategies,
l
-lysine was employed to produce 110.5 g/L hydroxylysine, which was subsequently decarboxylated to generate a 2-OH-PDA titre of 80.5 g/L with 62.6% molar yield in a 5-L fermenter. In addition, 2-OH-PDA with 95.6% purity was obtained by solid-phase extraction. Thus, the proposed two-stage whole-cell biocatalysis approach is a green and effective method for producing 2-OH-PDA on an industrial scale.
Conclusions
The whole-cell catalytic system showed a sufficiently high capability to convert lysine into 2-OH-PDA. Furthermore, the high titre of 2-OH-PDA is conducive to separation and possesses the prospect of industrial scale production by whole-cell catalysis.
Journal Article
A Non-linear Model Predictive Control Based on Grey-Wolf Optimization Using Least-Square Support Vector Machine for Product Concentration Control in l-Lysine Fermentation
2020
l-Lysine is produced by a complex non-linear fermentation process. A non-linear model predictive control (NMPC) scheme is proposed to control product concentration in real time for enhancing production. However, product concentration cannot be directly measured in real time. Least-square support vector machine (LSSVM) is used to predict product concentration in real time. Grey-Wolf Optimization (GWO) algorithm is used to optimize the key model parameters (penalty factor and kernel width) of LSSVM for increasing its prediction accuracy (GWO-LSSVM). The proposed optimal prediction model is used as a process model in the non-linear model predictive control to predict product concentration. GWO is also used to solve the non-convex optimization problem in non-linear model predictive control (GWO-NMPC) for calculating optimal future inputs. The proposed GWO-based prediction model (GWO-LSSVM) and non-linear model predictive control (GWO-NMPC) are compared with the Particle Swarm Optimization (PSO)-based prediction model (PSO-LSSVM) and non-linear model predictive control (PSO-NMPC) to validate their effectiveness. The comparative results show that the prediction accuracy, adaptability, real-time tracking ability, overall error and control precision of GWO-based predictive control is better compared to PSO-based predictive control.
Journal Article