Catalogue Search | MBRL
Search Results Heading
Explore the vast range of titles available.
MBRLSearchResults
-
DisciplineDiscipline
-
Is Peer ReviewedIs Peer Reviewed
-
Item TypeItem Type
-
SubjectSubject
-
YearFrom:-To:
-
More FiltersMore FiltersSourceLanguage
Done
Filters
Reset
94
result(s) for
"beef meatballs"
Sort by:
Detection of Pork in Beef Meatballs Using LC-HRMS Based Untargeted Metabolomics and Chemometrics for Halal Authentication
2022
Adulteration of high-quality meat products using lower-priced meats, such as pork, is a crucial issue that could harm consumers. The consumption of pork is strictly forbidden in certain religions, such as Islam and Judaism. Therefore, the objective of this research was to develop untargeted metabolomics using liquid chromatography-high resolution mass spectrometry (LC-HRMS) combined with chemometrics for analysis of pork in beef meatballs for halal authentication. We investigated the use of non-targeted LC-HRMS as a method to detect such food adulteration. As a proof of concept using six technical replicates of pooled samples from beef and pork meat, we could show that metabolomics using LC-HRMS could be used for high-throughput screening of metabolites in meatballs made from beef and pork. Chemometrics of principal component analysis (PCA) was successfully used to differentiate beef meatballs and pork meatball samples. Partial least square-discriminant analysis (PLS-DA) clearly discriminated between halal and non-halal beef meatball samples with 100% accuracy. Orthogonal projection to latent structures-discriminant analysis (OPLS-DA) perfectly discriminated and classified meatballs made from beef, pork, and a mixture of beef-pork with a good level of fitness (R2X = 0.88, R2Y = 0.71) and good predictivity (Q2 = 0.55). Partial least square (PLS) and orthogonal PLS (OPLS) were successfully applied to predict the concentration of pork present in beef meatballs with high accuracy (R2 = 0.99) and high precision. Thirty-five potential metabolite markers were identified through VIP (variable important for projections) analysis. Metabolites of 1-(1Z-hexadecenyl)-sn-glycero-3-phosphocholine, acetyl-l-carnitine, dl-carnitine, anserine, hypoxanthine, linoleic acid, and prolylleucine had important roles for predicting pork in beef meatballs through S-line plot analysis. It can be concluded that a combination of untargeted metabolomics using LC-HRMS and chemometrics is promising to be developed as a standard analytical method for halal authentication of highly processed meat products.
Journal Article
Effect of texturised soy protein and yeast on the instrumental and sensory quality of hybrid beef meatballs
2019
The study aimed to investigate the effect of introducing texturized soy protein (TSP) at different levels (15% and 30%) with and without nutritional yeast as flavour enhancer on the sensory and instrumental quality of beef meatballs, compared to a soy and yeast-free control. Proximate analysis, colour, instrumental texture, cook loss, and sensory quality were investigated. Sixty participants assessed the samples using Check-all-that-apply (CATA) questions and hedonic scales. Overall, the texture of all TSP-containing samples received significantly higher acceptability scores than control, while 15% TSP with yeast received the highest flavour and overall acceptability scores. Penalty-lift analysis of CATA terms identified the main drivers for liking as “moist looking”, “juicy”, “soft” and “crumbly and easy to cut”. Control samples were significantly more often associated than the other recipes to the term “hard”, a key driver for dislike and the least associated to “soft” and “crumbly and easy to cut”. Adding 15–30% TSP with or without yeast inclusion could be beneficial for the development of future meat hybrids with acceptable sensory quality.
Journal Article
An overview of factors affecting the quality of beef meatballs: Processing and preservation
2022
Beef meatball (BM) is a traditional delicious snack with rich nutrition and unique flavor, making it a preferred choice for most consumers. However, the quality of BM is easily affected by many factors, such as the processing, storage, and preservation, which limit the competitive positioning with respect to its market. Therefore, it is essential to pay attention to each step during the processing of BMs. Based on previous studies, this systematic review focuses on the effect of key processing factors (including raw materials and ingredients, beating, cooking methods, storage, and preservation) on the quality of BMs. Additionally, this study assessed the effect of each process factor on the physicochemical, sensory, nutritional, and safety attributes of BMs. Finally, the existing review will be beneficial in examining/describing the factors impacting the quality of BMs during processing, which would provide theoretical reference and scientific basis for the standardization and industrialization of BMs. Based on previous studies, this systematic review focuses on the effect of key processing factors (including raw materials and ingredients, beating, cooking methods, storage, and preservation) on the quality of beef meatballs (BMs).
Journal Article
Influence of Reheating Methods and Frozen Storage on Physicochemical Characteristics and Warmed-Over Flavor of Nutmeg Extract-Enriched Precooked Beef Meatballs
by
Parvin, Rashida
,
Seo, Jin-Kyu
,
Zahid, Md. Ashrafuzzaman
in
adhesion
,
antioxidant activity
,
Antioxidants
2020
The effects of convection-oven precooking, frozen storage (−18 °C/ two months) and four different reheating methods—namely, boiling, pan-roasting, convection oven and microwave oven on pH, color, texture, antioxidant activity and warmed-over flavor of beef meatballs were investigated. In this study, four kinds of beef meatballs were prepared: with added butylated hydroxyl toluene (0.02% BHT, M1); with nutmeg extract (0.02%, M2); with nutmeg powder (0.02%, M3) and control (no antioxidant). Addition of (0.02%) nutmeg extracts in beef meatballs M2 resulted in a significant (p < 0.05) decrease in lipid and protein oxidation, hardness and gumminess values after convection oven precooking. Again, M2 reheated by microwave oven significantly (p < 0.05) reduced cooking loss, gumminess, springiness, rancid flavor, saltiness and burnt taste and increased oxidative stability, redness and adhesiveness with the chewiness intensity and overall acceptability compared to control, M1 and M3. Conclusively, the addition of nutmeg extracts (0.02%) as a natural plant antioxidant to precooked beef meatballs can result in reduced lipid and protein oxidation levels, stabilized color and texture values and improved overall acceptance after reheated by microwave oven during two months of frozen storage.
Journal Article
Antimicrobial Effect of Moringa oleifera Leaves Extract on Foodborne Pathogens in Ground Beef
by
Abdallah, Reda
,
Morar, Adriana
,
Sallam, Khalid Ibrahim
in
adverse effects
,
Antiinfectives and antibacterials
,
Antimicrobial activity
2023
Consumers nowadays are becoming more aware of the importance of using only meat products containing safe and natural additives. Hence, using natural food additives for extending the shelf life of meat along with delaying microbial growth has become an urgent issue. Given the increasingly popular view of Moringa oleifera leaves as a traditional remedy and also the scarcity of published data concerning its antimicrobial effect against foodborne pathogens in meat and meat products, we designed the present study to investigate the antimicrobial effect of Moringa oleifera leaves aqueous extract (0.5%, 1%, and 2%) on ground beef during refrigerated storage at 4 °C for 18 days. MLE revealed potent antimicrobial properties against spoilage bacteria, such as aerobic plate count and Enterobacteriaceae count. MLE 2% showed a significant (p < 0.01) reduction in the counts of E. coli O157:H7, Salmonella enterica serovar Typhimurium, and Staphylococcus aureus artificially inoculated to ground beef by 6.54, 5.35, and 5.40 log10 CFU/g, respectively, compared to control, by the 18th day of storage. Moringa leaves extract (MLE) had no adverse effect on the overall acceptability and other sensory attributes; moreover, it induced a slight improvement in the tenderness and juiciness of treated ground beef, compared to the control. Therefore, MLE can be used as a healthy, natural, and safe preservative to increase meat products’ safety, quality, and shelf stability during cold storage. A promising approach for using natural food additives rather than chemical preservatives could begin new frontiers in the food industry, as they are more safe and do not constitute health risks to consumers.
Journal Article
Effect of sodium bicarbonate with ultrasound on reduced‐salt Chaozhou beef meatballs quality: Physicochemical and sensory properties
2024
This study aimed to create a reduced‐salt version of Chaozhou beef meatballs (CBMs) by employing ultrasound treatment (0 and 30 min) combined with sodium bicarbonate (0%, 0.15%, and 0.3%). The ultrasound‐assisted sodium bicarbonate treatment significantly enhanced pH, salt‐soluble protein solubility (SSP), water‐holding capacity (WHC), and storage modulus (G′) of the CBMs (p < 0.05). Specifically, after treatment, the increase in pH value promoted the solubilization of SSP, with the content increasing from 28.23% to 56.53%. Moreover, the initial relaxation times (T21 and T22) were shortened, indicating a decrease in water mobility, as evidenced by an increase in WHC from 85% to 87%. Furthermore, the ultrasound treatment effectively facilitated protein unfolding, increased β‐sheet secondary structure content, augmented hydrogen and disulfide bond proportions, and resulted in a denser and more uniform gel structure. Consequently, the hardness of the CBMs was significantly improved (p < 0.05). Sensory evaluation revealed that the treated reduced‐salt CBMs were comparable to those produced by conventional methods. Therefore, combining sodium bicarbonate with ultrasound treatment is a viable approach to mitigate the negative effects of reduced salt content and produce high‐quality reduced‐salt CBMs. Ultrasound‐assisted sodium bicarbonate reduced the adverse effects of salt reduction. Excessive sodium bicarbonate can cause damage to the structure of beef meatballs. Sensory evaluation of reduced‐salt beef meatballs was similar to that of regular products.
Journal Article
Synergistic effect of protease and cranberry powder to enhance the quality characteristics of fried beef meatballs
2023
Tenderness and color affect meat quality. Our previous results indicated that cranberry powder can partially replace NaNO2 in fried beef meatballs processing without compromising on its quality, especially the color. In this research, the effect of different protease enzymes combined with 10 g/kg cranberry powder for improving the quality, characteristics of fried beef meatballs were investigated. Addition of protease together with cranberry powder, the tenderness, a* value, and sensory score of fried beef meatballs were improved as a whole compared with sole 10 g/kg cranberry powder addition, indicating that protease had a beneficial effect on improving the quality of fried beef meatballs. Among the different proteases screened, the fried beef meatballs prepared with 80 U/g bromelain had a relatively higher a* value (13.06) and tenderness (12.61), and the overall acceptability (6) was the highest. Meanwhile, this combination exhibited lower shear stress and cooking loss, with higher water‐holding capacity and protein content. The effects of marination time on the physicochemical properties of fried beef meatballs were also investigated. Marinating for 8 h displayed the best effect with the highest a* value, the lowest shear force. The current study provides a potential solution for the quality improvement of fried beef meatballs. In the present study, the effect of papain, bromelain, and ficin in different concentrations combined with 10 g/kg cranberry powder for improving the quality properties of fried beef meatballs were investigated, respectively. Different quality characteristics index, such as color, shearing force, texture, and protein solubility of fried beef balls were investigated and compared, and the best combination formula was acquired. The relationship between protease and cranberry powder was also discussed. The current study would provide more convincing evidence for recommending the addition of cranberry powder together with bromelain during fried beef meatballs processing to further improve its qualities.
Journal Article
Shelf-life and antioxidant activity of beef meatball containing api-api mangrove (Avicennia marina) leaf flour
2024
Api-Api Mangrove ( Avicennia marina ) is one of the pioneers in the mangrove forest ecosystem. Avicennia marina belongs to the Verbenaceae family and is a cosmopolitan plant distributed along tropical and sub-tropical coastlines. Api-Api Mangrove ( Avicennia marina ) is a plant that is rich in bioactive substances such as antibacterial and antioxidant which are good for food preservation. Meatball is the one of the meat products which is easily damaged by bacteria and has a short shelf life. This study aimed to evaluate the microbiology quality and antioxidant activity of beef meatballs containing Api-Api Mangrove ( Avicennia marina ) leaf flour as a natural preservative. This research used a factorial completely randomized design. The treatments were meatballs containing Avicennia marina leaf flour 0%, 5%, 10%, 15%, and 20% that were refrigerated during 5 different storage times (at 0, 2, 4, 6, and 8 days). The shelf life of the meatballs was evaluated for microbial content, initially and at 2, 4, 6, and 8 days (S0, S2, S4, S6, and S8) using a standard total plate count method. Antioxidant activity was analyzed at S0 and S8. Analysis of Variance (ANOVA) was used to examine shelf life, and Duncan’s Multiple Range Test followed. Descriptive analysis was done on antioxidant activity. The results showed that the treatments did not significant on the shelf life of the meatballs. The shelf life of meatballs containing 20% of Avicennia marina leaf flour was longer (P<0,05) than other treatments. On the fourth day of storage, the meatballs were spoilage as indicated by the number of bacteria reaching 10 6 colonies per gram except the meatballs containing 20% of Avicennia marina leaf flour. These indicated that the Avicennia marina leaf flour can suppress the growth of bacteria. The antioxidant activity of meatballs containing Avicennia marina leaf flour was higher than those of the control. It can be concluded that the use of Avicennia marina leaf flour can be used as a natural preservative to support the resilience of the food sector.
Journal Article
Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia
2020
Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.
Journal Article