Catalogue Search | MBRL
Search Results Heading
Explore the vast range of titles available.
MBRLSearchResults
-
DisciplineDiscipline
-
Is Peer ReviewedIs Peer Reviewed
-
Item TypeItem Type
-
SubjectSubject
-
YearFrom:-To:
-
More FiltersMore FiltersSourceLanguage
Done
Filters
Reset
4,091
result(s) for
"green tissues"
Sort by:
Chloroplast development in green plant tissues
by
Luginbuehl, Leonie H.
,
Lopez-Juez, Enrique
,
Schreier, Tina B.
in
Amino acids
,
Angiosperms
,
Arabidopsis Proteins - metabolism
2022
Chloroplasts are best known for their role in photosynthesis, but they also allow nitrogen and sulphur assimilation, amino acid, fatty acid, nucleotide and hormone synthesis. How chloroplasts develop is therefore relevant to these diverse and fundamental biological processes, but also to attempts at their rational redesign. Light is strictly required for chloroplast formation in all angiosperms and directly regulates the expression of hundreds of chloroplast-related genes. Light also modulates the levels of several hormones including brassinosteriods, cytokinins, auxins and gibberellins, which themselves control chloroplast development particularly during early stages of plant development. Transcription factors such as GOLDENLIKE1&2 (GLK1&2), GATA NITRATE-INDUCIBLE CARBON METABOLISM-INVOLVED (GNC) and CYTOKININ-RESPONSIVE GATA FACTOR 1 (CGA1) act downstream of both light and phytohormone signalling to regulate chloroplast development. Thus, in green tissues transcription factors, light signalling and hormone signalling form a complex network regulating the transcription of chloroplast- and photosynthesis-related genes to control the development and number of chloroplasts per cell.Weuse this conceptual framework to identify points of regulation that could be harnessed to modulate chloroplast abundance and increase photosynthetic efficiency of crops, and to highlight future avenues to overcome gaps in current knowledge.
Journal Article
Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar
by
Blumwald, Eduardo
,
Rubio‐Wilhelmi, Maria M.
,
Ahkami, Amir H.
in
BASIC BIOLOGICAL SCIENCES
,
Biodiesel fuels
,
Biofuels
2024
Summary Synthetic promoters may be designed using short cis‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar (Populus tremula × Populus alba), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA) and Syn3‐10b‐2 (3′: GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.
Journal Article
Green tissue-targeted expression of the Cry1Ab/c gene in transgenic maize using the Cre/loxP system as an alternative strategy against lepidopteran pests
by
Li, Youliang
,
Shen, Yaou
,
Yuan, Guangsheng
in
Animals
,
Bacillus thuringiensis Toxins
,
Bacterial Proteins - genetics
2023
Genetically modified (GM) proteins in edible tissues of transgenic maize are of intense public concern. We provided a Cre/loxP-based strategy for manipulating the expression of transgenes in green tissues while locking them in nongreen tissues. First, the Cre gene was driven by the green tissue-specific promoter Zm1rbcS to generate transgenic maize KEY. Meanwhile, a gene cassette containing a Nos terminator (NosT) in front of the Cry1Ab/c gene was driven by the strong promoter ZmUbi to generate another transgenic maize LOCK. By crossing KEY and LOCK plants, the expressed Cre recombinase under the control of the Zm1rbcS promoter from KEY maize accurately removed the NosT of LOCK maize. Consequently, the expression of blocked Cry1Ab/c was enabled in specific green tissues in their hybrids. The expression level and concentration of Cry1Ab/c were observed using a strategy with high specific accumulation in green tissues (leaf and stem). Still, only a small or absent amount was observed in root and kernel tissues. Furthermore, we assessed the bioactivity of transgenic maize against 2 common lepidopteran pests, Ostrinia furnacalis and Spodoptera frugiperda, in the laboratory and field. The transgenic plants showed high plant resistance levels against the 2 pests, with mortality rates above 97.2% and damage scales below 2.2 compared with the control group. These findings are significant for exploring novel genetic engineering techniques in GM maize and providing a feasible strategy for transgenes avoiding expression in edible parts. In addition, implementing the Cre/loxP-mediated system could relieve public sentiment toward the biosafety of GM plants.
Journal Article
Low temperature modifies seedling leaf anatomy and gene expression in Hypericum perforatum
2022
Hypericum perforatum , commonly known as St John’s wort, is a perennial herb that produces the anti-depression compounds hypericin (Hyp) and hyperforin. While cool temperatures increase plant growth, Hyp accumulation as well as changes transcript profiles, alterations in leaf structure and genes expression specifically related to Hyp biosynthesis are still unresolved. Here, leaf micro- and ultra-structure is examined, and candidate genes encoding for photosynthesis, energy metabolism and Hyp biosynthesis are reported based on transcriptomic data collected from H. perforatum seedlings grown at 15 and 22°C. Plants grown at a cooler temperature exhibited changes in macro- and micro-leaf anatomy including thicker leaves, an increased number of secretory cell, chloroplasts, mitochondria, starch grains, thylakoid grana, osmiophilic granules and hemispherical droplets. Moreover, genes encoding for photosynthesis (64-genes) and energy (35-genes) as well as Hyp biosynthesis (29-genes) were differentially regulated with an altered growing temperature. The anatomical changes and genes expression are consistent with the plant’s ability to accumulate enhanced Hyp levels at low temperatures.
Journal Article
Isolation and Characterization of a Green-Tissue Promoter from Common Wild Rice (Oryza rufipogon Griff.)
by
Huang, Ke
,
Zhang, Tianbao
,
Huang, Gege
in
Abiotic stress
,
Arabidopsis - genetics
,
Arabidopsis - growth & development
2018
Promoters play a very important role in the initiation and regulation of gene transcription. Green-tissue promoter is of great significance to the development of genetically modified crops. Based on RNA-seq data and RT-PCR expression analysis, this study screened a gene, OrGSE (GREEN SPECIAL EXPRESS), which is expressed specifically in green tissues. The study also isolated the promoter of the OrGSE gene (OrGSEp), and predicted many cis-acting elements, such as the CAAT-Box and TATA-Box, and light-responding elements, including circadian, G-BOX and GT1 CONSENSUS. Histochemical analysis and quantification of GUS activity in transgenic Arabidopsis thaliana plants expressing GUS under the control of OrGSEp revealed that this promoter is not only green tissue-specific, but also light-inducible. The ability of a series of 5’-deletion fragments of OrGSEp to drive GUS expression in Arabidopsis was also evaluated. We found that the promoter region from −54 to −114 is critical for the promoter function, and the region from −374 to −114 may contain core cis-elements involved in light response. In transgenic rice expressing GUS under the control of OrGSEp, visualization and quantification of GUS activity showed that GUS was preferentially expressed in green tissues and not in endosperm. OrGSEp is a useful regulatory element for breeding pest-resistant crops.
Journal Article
Isolation and Functional Characterization of a Green-Tissue Promoter in Japonica Rice (Oryza sativa subsp. Japonica)
2022
Plant promoters play a vital role in the initiation and regulation of gene transcription. In this study, a rice protein/gene of unknown expression, named Os8GSX7, was gained from a rice T-DNA capture line. The semi-quantitative RT-PCR analysis showed that the gene was only expressed in root, glume, and flower, but not in stem, leaf, embryo, and endosperm of japonica rice. The GUS activity analysis of the GSX7R promoter showed that it was a reverse green tissue expression promoter, except in endosperm. The forward promoter of GSX7 cannot normally drive the expression of the foreign GUS gene, while the reverse promoter of GSX7 is a green tissue-specific expression promoter, which can drive the expression of the foreign GUS gene. The region from −2097 to −1543 bp was the key region for controlling the green tissue-specific expression. The regulatory sequences with different lengths from the 2097 bp reverse sequence from the upstream region of the Os8GSX7 were fused with the GUS reporter gene and stably expressed in rice. Furthermore, transgenic rice plants carrying Cry1Ab encoding Bacillus thuringiensis endotoxin, regulated by GSX7R, were resistant to yellow stem borer. The analysis suggested that 10 light responsive elements of tissue-specific expression were found, including ACE, Box4, CAT-box, G-Box, G-box, GATA motif, GC motif, I-box, Sp1, and chs-unit1 M1. In addition, the results of 5′ and 3′ deletions further speculated that ACE and I-box may be the key elements for determining the green tissue-specific expression of GSX7R promoter.
Journal Article
Two novel positive cis-regulatory elements involved in green tissue-specific promoter activity in rice (Oryza sativa L ssp.)
by
Zhou, Fei
,
Ye, Rongjian
,
Lin, Yongjun
in
agricultural biotechnology
,
beta-glucuronidase
,
Biological and medical sciences
2012
In plant genetic engineering, using tissue-specific promoters to control the expression of target gene is an effective way to avoid potential negative effects of using constitutive promoter, such as metabolic burden and so on. However, until now, there are few tissue-specific promoters with strong and reliable expression that could be used in crop biotechnology application. In this study, based on microarray and RT-PCR data, we identified a rice green tissue-specific expression gene DX1 (LOC_Os12g33120). The expression pattern of DX1 gene promoter was examined by using the β-glucuronidase (GUS) reporter gene and analyzed in transgenic rice plants in different tissues. Histochemical assays and quantitative analyses of GUS activity confirmed that P DX1 :GUS was highly expressed in green tissues. To identify the regulatory elements controlling the expression of the DX1 gene, a series of 5′ and 3′ deletions of DX1 promoter were fused to GUS gene and stably introduced into rice plants. In addition, gel mobility shift assays and site-directed mutagenesis studies were used, allowing for the identification of two novel tissue-specific cis-acting elements (GSE1 and GSE2) within P DX1 . GSE1 acted as a positive regulator in all green tissues (leaf, sheath, stem and panicle). Compared with GSE1, GSE2 acted as a positive regulator only in sheath and stem tissue, and had a weaker effect on gene expression. In addition, P DX1 :GUS was not expressed in anther and seed, this characteristic reduced the potential ecological risk and potential food safety issues. Taken together, our results strongly suggest that the identified promoter, P DX1 , and its cis regulatory elements, GSE1 and GSE2, are potentially useful in the field of rice transgenic breeding. KEY MESSAGE: We have isolated and characterized the rice green tissue-specific promoter P DX1 , and identified two novel positive cis-acting elements in P DX1 .
Journal Article
Creation of Bt Rice Expressing a Fusion Protein of Cry1Ac and Cry1I-Like using a Green Tissue-Specific Promoter
by
Yang, Yong-Yi
,
Shen, Zhicheng
,
Zhang, Wei
in
Animals
,
Bacillus thuringiensis
,
bacterial proteins
2014
The insecticidal genes from Bacillus thuringiensis Berliner (Bt) have long been successfully used for development of insect-resistant rice. However, commercial planting of Bt rice has been delayed by the concern over food safety, although no scientific evidence is ever found to justify the concern. To address this safety concern, we developed a transgenic insect-resistant rice line using a green tissue promoter to minimize the Bt protein expression in the rice seeds. The Bt protein expressed in the rice was a fusion protein of two different Bt toxins, Cry1Ac and Cry1I-like protein. The fusion of the two toxins may be helpful to delay the development of insect resistance to Bt rice. Laboratory and field bioassays demonstrated that the transgenic rice plants created by this study were highly active against the rice leaf folder Cnaphalocrocis medinalis (Guenée) and the striped stem borer Chilo suppressalis (Walker). Western analysis indicated that the fusion protein was specifically expressed in green tissues but not in seeds. Therefore, the transgenic rice created in this study should be useful to mitigate the food safety concern and to delay the development of insect resistance.
Journal Article
Marker-free transgenic rice expressing the vegetative insecticidal protein (Vip) of Bacillus thuringiensis shows broad insecticidal properties
by
Mitra, Joy
,
Chakraborty, Anirban
,
Gupta, Snehasish Dutta
in
Agriculture
,
Animals
,
Bacillus thuringiensis
2016
For sustainable resistance against lepidopteran insect pests, chloroplast targeted synthetic version of bioactive core component of a vegetative insecticidal protein (Syn - vip3BR) of Bacillus thuringiensis was expressed in rice under the control of green-tissue specific ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit gene promoter. The transgenic plants (in Oryza sativa indica Swarna cultivar) showed high insect mortality rate in vitro against major rice pests, yellow stem borer (Scirpophaga incertulas), rice leaf folder (Cnaphalocrocis medinalis) and rice horn caterpillar (Melanitis leda ismene) in T₁ generation, indicating insecticidal potency of Syn vip3BR. Under field conditions, the T₁ plants showed considerable resistance against leaf folders and stem borers. The expression cassette (vip-lox-hpt-lox) as well as another vector with chimeric cre recombinase gene under constitutive rice ubiquitin1 gene promoter was designed for the elimination of selectable marker hygromycin phosphotransferase (hptII) gene. Crossing experiments were performed between T₁ plants with single insertion site of vip-lox-hpt-lox T-DNA and one T₁ plant with moderate expression of cre recombinase with linked bialaphos resistance (syn bar) gene. Marker gene excision was achieved in hybrids with up to 41.18 % recombination efficiency. Insect resistant transgenic lines, devoid of selectable marker and redundant transgene(s) (hptII + cre-syn bar), were established in subsequent generation through genetic segregation.
Journal Article
Biotic- and abiotic-driven variations of the night-time sap flux of three co-occurring tree species in a low subtropical secondary broadleaf forest
2018
Abstract
Although several studies on the night-time water use of different plant species have been reported, comparative studies under the same climatic conditions of a region are scarce. This study aimed to analyse the inter- and intraspecific variations in night-time water use in relation to environmental factors and to tree morphological features to understand and elucidate the possible underlying mechanisms. The sap flow of three co-occurring tree species in a low subtropical secondary broadleaf forest in South China was monitored using Granier-style sap flux sensors. All examined environmental factors except wind speed exerted significant influence on the daytime sap flows of Schima superba, Castanopsis hystrix and Michelia macclurei, but the impacts of all factors, including wind speed, on the night-time sap flux were trivial. These results indicated that sap flow was mainly used for water recharge at night. The morphological features of the trees, except tree height, significantly affected the daytime water use, but no morphological features significantly affected the night-time water use. We found that night-time water recharge was strongly affected by the maximum flux density. A principal component analysis showed that there were more intraspecific than interspecific variations in water transport. The results also revealed that the night-time water use and the percentage of night/day (Qn/Qd) of photosynthetic stem species (C. hystrix and M. macclurei) were greater than those of non-photosynthetic stem species (S. superba).
Aiming to analyse the inter- and intraspecific variations in night-time water use, we used Granier-style sap flux sensors to monitor the sap flow of three co-occurring tree species in a low subtropical secondary broadleaf forest in South China. A principal component analysis showed that there were more intraspecific than interspecific variations in water transport. The results indicated that sap flow was mainly used for water recharge at night, and the night-time water use and the percentage of night/day (Qn/Qd) of photosynthetic stem species (Castanopsis hystrix and Michelia macclurei) were greater than those of non-photosynthetic stem species (Schima superba).
Journal Article