Explore the vast range of titles available.

In vitro oxidation is a problem for some herbaceous and woody species and can cause darkening of tissues and consequently death of explants and plants Therefore, this study aimed to assess the effect of activated charcoal on in vitro yam cultivation, aiming at reducing or eliminating explant oxidation and optimizing the growth of the genotypes Dioscorea alata var. purpurea (Roxb.) A. Pouchet and Dioscorea rotundata Poir. Nodal segments of approximately 1 cm, extracted from plants previously grown in vitro, were introduced into test tubes containing 10 mL of 2GGC culture medium, plus 30 g L-1 sucrose, solidified with 2.2 g L-1 Phytagel® and pH adjusted to 5.8 before autoclaving, containing activated charcoal doses of 0, 1, 2, 3 and 4 g L-1. Plants were maintained for 90 days in a growth room, with temperature of 27 ± 1ºC, photon flux density of 30 μmol m-2 s-1 and photoperiod of 16 hours, after which their development variables were evaluated. Activated charcoal, at the concentration of 4 g L-1 considerably promoted the best development of plants, and the species D. alata var. purpurea showed higher means for all variables studied.

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.

Using nanoparticles in agriculture requires a positive and eco-friendly response and a better understanding of their effects on plant cultures. Micropropagation is a recourse for the mass production and rescue of plant species that uses biotechnological tools in which it is possible to include nanoparticles for different purposes. In this study, zinc oxide nanoparticles (ZNPs) with an average size of 70 nm were biosynthesized with cell-free filtrate (CFF) from Mucor fragilis, the addition of ZNPs to the shoots of Agave salmiana var. Ayoteco, in their multiplication stage, was evaluated. Agave seedlings treated with ZNPs generally showed organogenesis after 20 days, with an optimal production of 18 shoots. Depending on the treatment applied, the combination of NPs and intermediate concentrations of the studied regulators caused a modification of the structures in the shoots and seedlings, mainly in the stomata, without the accumulation of ZnO. The antioxidant activity in shoots and seedlings depended on the stress generated by abiotic agents, such as growth regulators and NPs, to which they were exposed.Key messageThe combination of extracellular biogenic zinc oxide nanoparticles and growth regulators reduced the time required for shoot generation in A. salmiana while simultaneously preventing microbial contamination of the culture medium.

Byblis , a small genus of carnivorous plants predominantly found in Australia, is characterized by its passive trapping mechanism and unique floral features. The chemical composition of Byblis , including identified phenylethanoid glycosides, particularly acteoside, highlights its pharmacological potential with various biological activities.  In vitro  culture techniques have been established for propagation, with micropropagation protocols developed for different Byblis species. However, information on genetic transformation, vital for trait modification and enhanced pharmacological interest, remains limited. This study focuses on optimizing micropropagation, adventitious regeneration, and genetic transformation methods for  Byblis liniflora . Adventitious regeneration rates were highest in medium with reduced Murashige and Skoog salts (MS/10) and sucrose (3 gL −1 ) concentrations. Zeatin supplementation (1 mgL −1 ) further improved regeneration rates and bud development with 100% of regenerated root explants and 8.8 shoots per explant. Liquid MB3 medium supplemented with indole-3-acetic acid (IAA) 5 mgL −1 facilitated efficient rooting and acclimatization. The establishment of an efficient Rhizobium -mediated genetic transformation method yielded transgenic plants expressing green fluorescent protein (GFP). Molecular analysis confirmed transgene integration, marking the first successful genetic transformation in the Byblis genus. These advancements pave the way for exploring gene function and enhancing pharmacological properties, thereby broadening our understanding and utilization of carnivorous plants like Byblis .

This study established in vitro root cultures of Tarenaya atropurpurea from root segments of seedlings and from in vitro propagated plants. Moreover, culture conditions were manipulated aiming to optimize root biomass accumulation and shoot regeneration from newly formed roots was determined. A phytochemical assessment was performed using two extraction methods — dynamic maceration (DM) and ultrasonic assisted extraction (UAE) — and two chromatographic methods for extract analysis (TLC and HPLC). MS medium supplemented with 3.0 mg.L− 1 of indole-3-butyric acid (IBA) induced the highest root multiplication. Root cultures initiated from seedling explants achieved higher biomass accumulation. However, improved root multiplication was achieved using explants from in vitro propagated plants in an optimized culture formulation called Optimum Root Culture Medium (ORCM), which combines MS medium with 1/4 concentration of mineral salts + 3.0 mg.L− 1 IBA + 70 g.L− 1 sucrose, pH 6.5, stirring speed at 130 r.p.m., and 16 h/light. Shoot regeneration from newly formed roots was successfully obtained on MS containing 6-benzylaminopurine (BA). Analysis by TLC suggests the presence of saponins, mainly in root extracts, with the most intense bands acquired by UAE, while HPLC analysis suggests the presence of flavonoids in extracts from aerial parts, with intense signals in extracts obtained by DM. This study was able to establish in vitro root cultures of T. atropurpurea and optimize root biomass accumulation through the manipulation of culture conditions. Phytochemical assessment indicated the presence of saponins and flavonoids, demonstrating potential commercial use of in vitro cultures to produce secondary metabolites in T. atropurpurea.Key messageIn vitro root culture of T. atropurpurea was established using root explants from seedlings and in vitro propagated plants. A phytochemical assessment was also performed, applying different extraction and chromatographic methods.

In vitro cultivation allows the propagation of plant species, the conservation of germplasm, the modification of cellular processes, and the obtaining of bioactive compounds. The Bromeliaceae family is distinguished by accumulating high contents of proteases in its organs. In Chile, it presents a high degree of endemism. The Puya genus is one of the most abundant, with great ecological, systematic, evolutionary, and biogeographic interest. Puya alpestris inhabits stony, arid, and semi-humid areas, and has long floral maturation times and very slow growth. Propagation by seeds does not guarantee the survival of natural populations for exploitation. The study aimed to evaluate the effect of different in vitro micropropagation methods of Puya alpestris on the synthesis and secretion of cysteine proteases. Shoots were grown from seeds germinated in vitro in various growth systems, such as semi-solid medium (SSM), liquid medium (LM) and temporary immersion systems (TIS). The combined effect of cutting and application of 0.5 uM 6-benzyl amino purine (BAP) and gibberellic acid (GA) favored the in vitro multiplication of the species. The study revealed that the cultivation method and the growth time significantly influenced the growth and morphological development of P. alpestris plants. Plants grown in liquid medium for 45 d showed a significant increase in morphological variables such as plant length, number of leaves, number of roots, and total biomass, as well as a greater physiological response in absolute growth rate (AGR) and net assimilation rate (NAR). Proteolytic extracts from plants grown in SSM for 45 d showed greater proteolytic activity. The contents of proteases released into the medium were higher in the LM culture. However, when propagating plants in TIS, the values of specific proteolytic activity in the medium were higher. This study proposes for the first time a protocol for the propagation and conservation of P. alpestris and supports the use of TIS to acquire new cysteine proteases.

Caper (Capparis spinosa L.) is a medical plant grown in Jordan. Mass harvesting of caper plants from their origin environments caused a reduction of these germplasm. Therefore, an easy and consistent method for clonal proliferation and callus induction was established for this species. C. spinosa L. in vitro culture affected in MS medium provided by 0.5 mg/L BAP gave 5.9 microshoots/explant. Two months later MS medium supplemented with 2.0 mg/L NAA developed a maximum callus induction of 33.1 mm. Ex vitro, in vitro, and callus growth of C. spinosa L. using ethanolic and methanolic extracts were tested for their antimicrobial activity against different species of bacteria and fungi. Both ex-vitro and in vitro plants exhibited similar antimicrobial activity. Maximum ex vitro plant antibacterial activity was (23 mm ± 0.58 inhibition zone) against Staphylococcus epidermidi. In comparison, callus extracts gave the highest antibacterial activity against Bacillus cereus and Escherichia coli. Moreover, caper plant extracts showed different antifungal effects against the tested fungi species. Investigation of the data showed that ex-vitro extract exhibited maximum antifungal activity compared to in vitro plants. Additionally, exposed Bemisia tabaci 4th nymphal instar to C. spinosa L. extracts suffered mortality ranging from 2 to 28%.  In most instances, both ethanolic and methanolic extracts affected the survival of B. tabaci more than the control. The current study confirmed that C. spinosa L. has a wide range of antibacterial, antifungal, and insecticidal activity. 

  Cotoneaster melanocarpus Fisch. ex A.Blytt (Rosaceae) is a deciduous shrub that is difficult to propagate through traditional methods. Thus, in the present study, in vitro regeneration utilizing nodal explants was attempted for the first time. Murashige and Skoog (MS) and Quoirin and Lepoivre (QL) medium supplemented with 0.2 or 0.5 mg L −1 6-benzyladenine (BA), 0.01 mg L −1 indole-3-butyric acid (IBA), and 0.5 mg L −1 gibberellic acid (GA 3 ) were utilized for shoot culture establishment. Optimum 8.83 ± 0.66 shoots with 0.87 ± 0.10 cm length and 4.27 ± 0.37 leaves per explant were recorded after 40 d in MS medium fortified with 0.2 mg L −1 BA, 0.01 mg L −1 IBA, and 0.5 mg L −1 GA 3 . These shoots were then rooted in ½MS medium augmented with 0.5 mg L −1 IBA which formed 4.03 ± 0.29 roots per shoot (100% response) with 3.64 ± 0.16 cm length. The plantlets were then transferred to soil:vermiculite (3:1 w/w) in the light room for 35 d. Later on, they were successfully hardened and acclimatized in open ground with 80.9% survival rate after 3 mo.

Areca concinna Thwaites (Arecaceae) is an endangered plant species endemic to South-Western Sri Lanka and distributed primarily in Sri Lanka, India, and Southeast Asia. This palm was listed under endangered plants species by IUCN (The International Union for Conservation of Nature) due to habitat loss. Clonal propagation is essential for conservation and maintenance of this endangered species. In an effort to conserve this plant species, a protocol was developed for clonal multiplication of A. concinna Thwaites. Immature inflorescence, immature embryos, and mature embryos were tested for callogenesis and subsequent somatic embryogenesis in M72 basal medium supplemented with the auxins 2,4-D and picloram. Of the three explants, somatic embryos were obtained only from mature embryos. Callus multiplication and somatic embryo formation in M72 basal medium supplemented with 2,4-D were found to be better over picloram media. Serial transfer of explants from higher to lower concentrations was essential for sustaining the multiplication of callus as well as for induction of somatic embryos. Somatic embryos grown in Y3 or 1/2 Y3 basal medium supplemented with 1.0 mg L −1 BAP, 0.5 mg L −1 NAA, and 0.25 mg L −1 IBA exhibited shoot initiation and plantlet development. This protocol has its application in rapid multiplication of A. concinna Thwaites palms thereby enhancing the possibility of conservation of the endangered palm.