MbrlCatalogueTitleDetail

Do you wish to reserve the book?
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
Hey, we have placed the reservation for you!
Hey, we have placed the reservation for you!
By the way, why not check out events that you can attend while you pick your title.
You are currently in the queue to collect this book. You will be notified once it is your turn to collect the book.
Oops! Something went wrong.
Oops! Something went wrong.
Looks like we were not able to place the reservation. Kindly try again later.
Are you sure you want to remove the book from the shelf?
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
Oops! Something went wrong.
Oops! Something went wrong.
While trying to remove the title from your shelf something went wrong :( Kindly try again later!
Title added to your shelf!
Title added to your shelf!
View what I already have on My Shelf.
Oops! Something went wrong.
Oops! Something went wrong.
While trying to add the title to your shelf something went wrong :( Kindly try again later!
Do you wish to request the book?
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA

Please be aware that the book you have requested cannot be checked out. If you would like to checkout this book, you can reserve another copy
How would you like to get it?
We have requested the book for you! Sorry the robot delivery is not available at the moment
We have requested the book for you!
We have requested the book for you!
Your request is successful and it will be processed during the Library working hours. Please check the status of your request in My Requests.
Oops! Something went wrong.
Oops! Something went wrong.
Looks like we were not able to place your request. Kindly try again later.
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
Journal Article

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA

2019
Request Book From Autostore and Choose the Collection Method
Overview
The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

MBRLCatalogueRelatedBooks