Asset Details
MbrlCatalogueTitleDetail
Do you wish to reserve the book?
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
by
Alimova, Yelena
, Kirakodu, Sreenatha
, Ebersole, Jeffrey L
, Gonzalez-Martinez, Janis
, Kozal, Anastasia
, Stromberg, Arnold J
, Al-Attar, Ahmad
, Novak, Michael John
, Martinez, Melween
, Orraca, Luis
, Gonzalez, Octavio A
2019
Hey, we have placed the reservation for you!
By the way, why not check out events that you can attend while you pick your title.
You are currently in the queue to collect this book. You will be notified once it is your turn to collect the book.
Oops! Something went wrong.
Looks like we were not able to place the reservation. Kindly try again later.
Are you sure you want to remove the book from the shelf?
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
by
Alimova, Yelena
, Kirakodu, Sreenatha
, Ebersole, Jeffrey L
, Gonzalez-Martinez, Janis
, Kozal, Anastasia
, Stromberg, Arnold J
, Al-Attar, Ahmad
, Novak, Michael John
, Martinez, Melween
, Orraca, Luis
, Gonzalez, Octavio A
in
2019
Oops! Something went wrong.
While trying to remove the title from your shelf something went wrong :( Kindly try again later!
Do you wish to request the book?
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
by
Alimova, Yelena
, Kirakodu, Sreenatha
, Ebersole, Jeffrey L
, Gonzalez-Martinez, Janis
, Kozal, Anastasia
, Stromberg, Arnold J
, Al-Attar, Ahmad
, Novak, Michael John
, Martinez, Melween
, Orraca, Luis
, Gonzalez, Octavio A
2019
Please be aware that the book you have requested cannot be checked out. If you would like to checkout this book, you can reserve another copy
We have requested the book for you!
Your request is successful and it will be processed during the Library working hours. Please check the status of your request in My Requests.
Oops! Something went wrong.
Looks like we were not able to place your request. Kindly try again later.
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
Journal Article
Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA 2 -IIA
2019
Request Book From Autostore
and Choose the Collection Method
Overview
The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.
MBRLCatalogueRelatedBooks
Related Items
Related Items
We currently cannot retrieve any items related to this title. Kindly check back at a later time.
This website uses cookies to ensure you get the best experience on our website.