Explore the vast range of titles available.

Past chemopreventive human trials on dietary selenium supplements produced controversial outcomes. They largely employed selenomethionine (SeM)-based diets. SeM was less toxic than selenite or methylseleninic acid (MSeA) to lung cancer cells. We thus investigated the toxic action of these Se agents in two non-small cell lung cancer (NSCLC) cell lines and ex vivo organotypic cultures (OTC) of NSCLC patient lung tissues. Stable isotope-resolved metabolomics (SIRM) using 13C6-glucose and 13C5,15N2-glutamine tracers with gene knockdowns were employed to examine metabolic dysregulations associated with cell type- and treatment-dependent phenotypic changes. Inhibition of key anaplerotic processes, pyruvate carboxylation (PyC) and glutaminolysis were elicited by exposure to MSeA and selenite but not by SeM. They were accompanied by distinct anabolic dysregulation and reflected cell type-dependent changes in proliferation/death/cell cycle arrest. NSCLC OTC showed similar responses of PyC and/or glutaminolysis to the three agents, which correlated with tissue damages. Altogether, we found differential perturbations in anaplerosis-fueled anabolic pathways to underlie the distinct anti-cancer actions of the three Se agents, which could also explain the failure of SeM-based chemoprevention trials.

Natural killer (NK) lymphocyte-mediated cytotoxicity and cytokine secretion control infections and cancers, but these crucial activities decline with age. NK cell development, homeostasis, and function require IL-15 and its chaperone, IL-15 receptor alpha (IL-15Rα). Macrophages and dendritic cells (DC) are major sources of these proteins. We had previously postulated that additional IL-15 and IL-15Rα is made by skeletal muscle and adipose tissue. These sources may be important in aging, when IL-15-producing immune cells decline. NK cells circulate through adipose tissue, where they may be exposed to local IL-15. The objectives of this work were to determine (1) if human muscle, subcutaneous adipose tissue (SAT), and visceral adipose tissue (VAT) are sources of IL-15 and IL-15 Rα, and (2) whether any of these tissues correlate with NK cell activity in elderly humans. We first investigated IL-15 and IL-15Rα RNA expression in paired muscle and SAT biopsies from healthy human subjects. Both tissues expressed these transcripts, but IL-15Rα RNA levels were higher in SAT than in skeletal muscle. We also investigated tissue obtained from surgeries and found that SAT and VAT expressed equivalent amounts of IL-15 and IL-15Rα RNA, respectively. Furthermore, stromal vascular fraction cells expressed more IL-15 RNA than did adipocytes. To test if these findings related to circulating IL-15 protein and NK cell function, we tested 50 healthy adults aged > 70 years old. Plasma IL-15 levels significantly correlated with abdominal VAT mass in the entire cohort and in non-obese subjects. However, plasma IL-15 levels did not correlate with skeletal muscle cross-sectional area and correlated inversely with muscle strength. Plasma IL-15 did correlate with NK cell cytotoxic granule exocytosis and with CCL4 (MIP-1β) production in response to NKp46-crosslinking. Additionally, NK cell responses to K562 leukemia cells correlated inversely with muscle strength. With aging, immune function declines while infections, cancers, and deaths increase. We propose that VAT-derived IL-15 and IL-15Rα is a compensatory NK cell support mechanism in elderly humans.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear. Herein, we identified the Notch-1/PLA2-IIA axis as a new molecular pathway through which Pg could be specifically modulating oral epithelial antimicrobial and inflammatory responses. Pg activated Notch-1, and inhibition or silencing of Notch-1 completely abrogated Pg-induced PLA2-IIA in oral epithelial cells (OECs). Activation of Notch-1 and PLA2-IIA production were associated with Pg-produced gingipains. Other oral Gram-positive and Gram-negative species failed to induce similar responses. Pg enhanced OEC antimicrobial activity through PLA2-IIA. Increased Notch-1 activation correlated with higher PLA2-IIA gingival expression and changes in the abundance of specific oral bacteria phyla during periodontal disease. Oral bacterial species exhibited differential antimicrobial susceptibility to PLA2-IIA. These findings support previous evidence suggesting an important role for epithelial Notch-1 activation and PLA2-IIA production during health and disease at mucosal surfaces, and provide new mechanistic information concerning the regulation of epithelial antimicrobial and pro-inflammatory responses modulated by oral pathogenic bacteria associated with periodontal disease.

Loss of heterozygosity (LOH) and homozygous deletions at chromosome 3p21.3 are common in both small and nonsmall cell lung cancers, indicating the likely presence of tumor suppressor genes (TSGs). Although genetic and epigenetic changes within this region have been identified, the functional significance of these changes has not been explored. Concurrent protein expression and genetic analyses of human lung tumors coupled with functional studies have not been done. Here, we show that expression of the 3p21.3 gene, LIMD1, is frequently down-regulated in human lung tumors. Loss of LIMD1 expression occurs through a combination of gene deletion, LOH, and epigenetic silencing of transcription without evidence for coding region mutations. Experimentally, LIMD1 is a bona fide TSG. Limd1⁻/⁻ mice are predisposed to chemical-induced lung adenocarcinoma and genetic inactivation of Limd1 in mice heterozygous for oncogenic K-RasG¹²D markedly increased tumor initiation, promotion, and mortality. Thus, we conclude that LIMD1 is a validated chromosome 3p21.3 tumor-suppressor gene involved in human lung cancer development. LIMD1 is a LIM domain containing adapter protein that localizes to E-cadherin cell-cell adhesive junctions, yet also translocates to the nucleus where it has been shown to function as an RB corepressor. As such, LIMD1 has the potential to communicate cell extrinsic or environmental cues with nuclear responses.

ObjectiveTo evaluate immunosurveillance/editing in colorectal cancer.DesignTransformation stimulates the production of interferon γ (IFNγ) which signals via the IFNγ receptor (IFNGR1) on tumours. This results in stimulation of nuclear STAT1 (nSTAT1), inhibition of tumour growth and upregulation of major histocompatibility complex (MHC) while promoting T cell extravasation. In contrast, downregulation of MHC class I by allele loss results in loss of T cell recognition. A tissue microarray of 462 colorectal tumours with mean follow-up of 42 months (range 1–116) was stained by immunohistochemistry for markers which predict immunosurveillance/editing.ResultsThe presence of a high level of intratumoral T cells (ITTC) correlated with improved survival compared with a low level of ITTC, with a mean difference in survival of 16.3 months (p=0.006). There was a direct correlation between nSTAT1 expression and ITTC (p<0.001). Patients whose tumours had a high level of ITTC and nSTAT1 survived 20 months longer than those whose tumours had a low level of ITTC and no nSTAT1. A strong correlation was seen between ITTC and MHC class I expression (p=0.0002). A mean survival advantage of 26.1 months was seen in patients whose tumours had strong MHC I expression and high levels of ITTC over those who had weak MHC I and low levels of ITTC (log-rank test=12.023, p=0.034). Both MHC I and ITTC are independent predictors of good survival.ConclusionsITTC, nSTAT1 and strong MHC class I expression on tumours identify patients with improved survival and an intact tumour immune system that may benefit from immunotherapy. Conversely, loss of these markers identifies patients whose tumours have escaped immunosurveillance and are unlikely to benefit from immunotherapy.

Natural killer (NK) and T lymphocytes share many properties, yet only NK cells respond rapidly to infection and cancer without pre-activation. We found that few microRNAs (miRNAs) differed significantly between human NK and T cells. Among those miRNAs, miR-181a and miR-181b levels rose during NK cell differentiation. Prior studies indicate that miR-181a and miR-181b are critical for human NK cell development and are co-transcribed from genes on chromosome 1 ( MIR181A1B1 ) and on chromosome 9 ( MIR181A2B2 ). We mapped human MIR181A1B1 and MIR181A2B2 transcription start sites to 78.3 kb and 34.0 kb upstream of the mature miRNAs, generating predominantly unspliced transcripts of 80–127 kb and ~60 kb, respectively. Unlike mouse thymocytes, human T cells expressed both MIR181A1B1 and MIR181A2B2 . We tested the hypothesis that NK cells differentially transcribe the two genes during development and in response to immune regulatory cytokines. During NK-cell differentiation, MIR181A2B2 expression rose markedly and exceeded that of MIR181A1B1 . TGF-β treatment increased NK-cell MIR181A2B2 transcription, whereas IL-2, IL-15 and IL-12/IL-18 treatments upregulated MIR181A1B1 . The MIR181A2B2 promoter was strongly transactivated by SMAD3 and SMAD4 transcription factors, suggesting that TGF-β signaling upregulates MIR181A2B2 expression, at least in part, through SMAD-dependent promoter activation.

IntroductionStable isotope tracers have been increasingly used in preclinical cancer model systems, including cell culture and mouse xenografts, to probe the altered metabolism of a variety of cancers, such as accelerated glycolysis and glutaminolysis and generation of oncometabolites. Comparatively little has been reported on the fidelity of the different preclinical model systems in recapitulating the aberrant metabolism of tumors.ObjectivesWe have been developing several different experimental model systems for systems biochemistry analyses of non-small cell lung cancer (NSCLC1) using patient-derived tissues to evaluate appropriate models for metabolic and phenotypic analyses.MethodsTo address the issue of fidelity, we have carried out a detailed Stable Isotope-Resolved Metabolomics study of freshly resected tissue slices, mouse patient derived xenografts (PDXs), and cells derived from a single patient using both 13C6-glucose and 13C5,15N2-glutamine tracers.ResultsAlthough we found similar glucose metabolism in the three models, glutamine utilization was markedly higher in the isolated cell culture and in cell culture-derived xenografts compared with the primary cancer tissue or direct tissue xenografts (PDX).ConclusionsThis suggests that caution is needed in interpreting cancer biochemistry using patient-derived cancer cells in vitro or in xenografts, even at very early passage, and that direct analysis of patient derived tissue slices provides the optimal model for ex vivo metabolomics. Further research is needed to determine the generality of these observations.

Neoadjuvant chemotherapy has become the standard of care for locally advanced primary breast cancer. Anthracycline-based regimens have proven to be one of the most effective treatments in this setting. As certain cytotoxic antineoplastic agents, such as anthracyclines, generate reactive oxygen species as a by-product of their mechanism of action, we examined whether redox protein expression was involved in the response to anthracycline-based chemotherapy and with clinical outcome. Pre-treatment needle core biopsy and post-anthracycline treatment tumour sections were analysed from 98 cases. In all, 32 individuals had a complete clinical response and 17 had a complete pathological response. Immunohistochemical staining was performed for eight redox proteins: thioredoxin, thioredoxin reductase, thioredoxin interacting protein (TxNIP), glutathione S-transferase (GST) π, θ and α, catalase and manganese superoxide dismutase. GST π (P=0.05) and catalase (P=0.045) were associated with pathological complete response in pre-chemotherapy samples. TxNIP (P=0.017) and thioredoxin reductase (P=0.022) were independent prognostic factors for distant metastasis-free survival and TxNIP for overall survival (P=0.014). In oestrogen receptor negative patients that are known to have a poor overall survival, a considerably worse prognosis was seen in cases that exhibited low expression of TxNIP (P=0.000003), stratifying patients into more defined groups. This study indicates the importance of redox regulation in determining breast cancer response to anthracycline-based chemotherapy and provides ways of further stratifying pre-chemotherapy patients to potentially allow more tailored treatments.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.