Search Results Heading

MBRLSearchResults

mbrl.module.common.modules.added.book.to.shelf
Title added to your shelf!
View what I already have on My Shelf.
Oops! Something went wrong.
Oops! Something went wrong.
While trying to add the title to your shelf something went wrong :( Kindly try again later!
Are you sure you want to remove the book from the shelf?
Oops! Something went wrong.
Oops! Something went wrong.
While trying to remove the title from your shelf something went wrong :( Kindly try again later!
    Done
    Filters
    Reset
  • Discipline
      Discipline
      Clear All
      Discipline
  • Is Peer Reviewed
      Is Peer Reviewed
      Clear All
      Is Peer Reviewed
  • Item Type
      Item Type
      Clear All
      Item Type
  • Subject
      Subject
      Clear All
      Subject
  • Year
      Year
      Clear All
      From:
      -
      To:
  • More Filters
48 result(s) for "Attachment Sites, Microbiological - physiology"
Sort by:
Epigenetic specifications of host chromosome docking sites for latent Epstein-Barr virus
Epstein-Barr virus (EBV) genomes persist in latently infected cells as extrachromosomal episomes that attach to host chromosomes through the tethering functions of EBNA1, a viral encoded sequence-specific DNA binding protein. Here we employ circular chromosome conformation capture (4C) analysis to identify genome-wide associations between EBV episomes and host chromosomes. We find that EBV episomes in Burkitt’s lymphoma cells preferentially associate with cellular genomic sites containing EBNA1 binding sites enriched with B-cell factors EBF1 and RBP-jK, the repressive histone mark H3K9me3, and AT-rich flanking sequence. These attachment sites correspond to transcriptionally silenced genes with GO enrichment for neuronal function and protein kinase A pathways. Depletion of EBNA1 leads to a transcriptional de-repression of silenced genes and reduction in H3K9me3. EBV attachment sites in lymphoblastoid cells with different latency type show different correlations, suggesting that host chromosome attachment sites are functionally linked to latency type gene expression programs. Epstein-Barr virus (EBV) episomes tether to the host chromosome via EBNA1. Here, using circular chromosome conformation capture (4C), Kim et al. identify attachment sites and show that EBV episomes preferentially associate with transcriptionally silenced genes in Burkitt lymphoma cells.
Integrons: agents of bacterial evolution
Key Points Integrons are assembly platforms that incorporate exogenous open reading frames through site-specific recombination and convert them to functional genes by ensuring their correct expression. Although integrons were discovered through their involvement in the development of multiple antibiotic resistance in Gram-negative pathogens when carried in transposons, their role in genome evolution has been extended with the discovery of other, often larger, integron structures as genuine components of the genomes of many γ-proteobacterial species. This Review discusses the structural differences among the different types of integron — those carried in mobile DNA elements and the chromosomal superintegrons — as well as their evolutionary history and phylogenetic relationships. The different functions encoded by the integron gene cassettes are reviewed, with emphasis on those from superintegrons and other chromosomal integrons from environmental bacteria. The dynamics of the intraspecies and interspecies variation of the large cassette arrays of superintegrons, and their role in the increase in antibiotic resistance, are discussed. Finally, the specific recombination reactions occurring in these elements are reviewed, and a novel model involving a single-stranded substrate for recombination for cassette insertion and deletion is proposed. Integrons are assembly platforms that incorporate exogenous open reading frames through site-specific recombination and convert them to functional genes by ensuring their correct expression. Here, Didier Mazel reviews the biology of integrons and superintegrons and their evolutionary history, and proposes a new model to account for the peculiarities of the integron recombination pathway. Integrons are assembly platforms — DNA elements that acquire open reading frames embedded in exogenous gene cassettes and convert them to functional genes by ensuring their correct expression. They were first identified by virtue of their important role in the spread of antibiotic-resistance genes. More recently, our understanding of their importance in bacterial genome evolution has broadened with the discovery of larger integron structures, termed superintegrons. These DNA elements contain hundreds of accessory genes and constitute a significant fraction of the genomes of many bacterial species. Here, the basic biology of integrons and superintegrons, their evolutionary history and the evidence for the existence of a novel recombination pathway is reviewed.
Retroviral DNA Integration: Viral and Cellular Determinants of Target-Site Selection
Retroviruses differ in their preferences for sites for viral DNA integration in the chromosomes of infected cells. Human immunodeficiency virus (HIV) integrates preferentially within active transcription units, whereas murine leukemia virus (MLV) integrates preferentially near transcription start sites and CpG islands. We investigated the viral determinants of integration-site selection using HIV chimeras with MLV genes substituted for their HIV counterparts. We found that transferring the MLV integrase (IN) coding region into HIV (to make HIVmIN) caused the hybrid to integrate with a specificity close to that of MLV. Addition of MLV gag (to make HIVmGagmIN) further increased the similarity of target-site selection to that of MLV. A chimeric virus with MLV Gag only (HIVmGag) displayed targeting preferences different from that of both HIV and MLV, further implicating Gag proteins in targeting as well as IN. We also report a genome-wide analysis indicating that MLV, but not HIV, favors integration near DNase I-hypersensitive sites (i.e., +/- 1 kb), and that HIVmIN and HIVmGagmIN also favored integration near these features. These findings reveal that IN is the principal viral determinant of integration specificity; they also reveal a new role for Gag-derived proteins, and strengthen models for integration targeting based on tethering of viral IN proteins to host proteins.
On Kinetics of Phage Adsorption
Adsorption of λ-phage on sensitive bacteria Escherichia coli is a classical problem but not all issues have been resolved. One of the outstanding problems is the rate of adsorption, which in some cases appears to exceed the theoretical limit imposed by the law of random diffusion. We revisit this problem by conducting experiments along with new theoretical analyses. Our measurements show that upon incubating λ-phage with bacteria Ymel, the population of unbound phage in a salt buffer decreases with time and in general obeys a double-exponential function characterized by a fast ( τ 1) and a slow ( τ 2) decay time. We found that both the fast and the slow processes are specific to interactions between λ-phage and its receptor LamB. Such specificity motivates a kinetic model that describes the interaction between the phage and the receptor as an on-and-off process followed by an irreversible binding. The latter may be a signature of the initiation of DNA translocation. The kinetic model successfully predicts the double exponential behavior seen in the experiment and allows the corresponding rate constants to be extracted from single measurements. The weak temperature dependence of the reversible and the irreversible binding rate suggests that phage retention by the receptor is entropic in nature and that a molecular key-lock interaction may be an appropriate description of the interaction between the phage tail and the receptor.
Tn7 transposition regulator TnsC interacts with the transposase subunit TnsB and target selector TnsD
The excision of transposon Tn7 from a donor site and its insertion into its preferred target site, attachment site attTn7 , is mediated by four Tn7 -encoded transposition proteins: TnsA, TnsB, TnsC, and TnsD. Transposition requires the assembly of a nucleoprotein complex containing all four Tns proteins and the DNA substrates, the donor site containing Tn7 , and the preferred target site attTn7 . TnsA and TnsB together form the heteromeric Tn7 transposase, and TnsD is a target-selecting protein that binds specifically to attTn7 . TnsC is the key regulator of transposition, interacting with both the TnsAB transposase and TnsD- attTn7 . We show here that TnsC interacts directly with TnsB, and identify the specific region of TnsC involved in the TnsB–TnsC interaction during transposition. We also show that a TnsC mutant defective in interaction with TnsB is defective for Tn7 transposition both in vitro and in vivo. Tn7 displays cis -acting target immunity, which blocks Tn7 insertion into a target DNA that already contains Tn7. We provide evidence that the direct TnsB–TnsC interaction that we have identified also mediates cis -acting Tn7 target immunity. We also show that TnsC interacts directly with the target selector protein TnsD.
Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system
Detailed analysis of neuronal network architecture requires the development of new methods. Here we present strategies to visualize synaptic circuits by genetically labelling neurons with multiple, distinct colours. In Brainbow transgenes, Cre/ lox recombination is used to create a stochastic choice of expression between three or more fluorescent proteins (XFPs). Integration of tandem Brainbow copies in transgenic mice yielded combinatorial XFP expression, and thus many colours, thereby providing a way to distinguish adjacent neurons and visualize other cellular interactions. As a demonstration, we reconstructed hundreds of neighbouring axons and multiple synaptic contacts in one small volume of a cerebellar lobe exhibiting approximately 90 colours. The expression in some lines also allowed us to map glial territories and follow glial cells and neurons over time in vivo . The ability of the Brainbow system to label uniquely many individual cells within a population may facilitate the analysis of neuronal circuitry on a large scale. Over the brainbow More than a century ago, Ramón Y Cajal's use of Golgi staining on nerve cells opened the door to modern neurobiology: by staining a small number of neurons, previously invisible axons and dendrites could be seen as they coursed through surrounding tissue. But Golgi staining can label only a small number of cells in one colour. Now, a team from Harvard University has developed a method that enables many distinct cells within a brain circuit to be viewed at one time. The 'Brainbow' technique can paint hundreds of individual neurons with distinctive hues, producing a detailed map of neuronal circuitry. This technology should not only boost mapping efforts in normal or diseased brains, but could also be applied to other complex cell populations, such as the immune system. The cover shows a portion of the hippocampus within a 'Brainbow' mouse. The multicoloured neurons of the dentate gyrus (bottom) lie beneath the cells of the arching CA1 region, while neurons of the cerebral cortex can be seen twinkling above. A combination of genetic tricks and fancy fluorescent proteins is used to develop the Technicolor version of Golgi staining, 'Brainbow', in which hundreds of individual neurons are painted, each with a distinctive hue. This technology should not only boost mapping efforts in normal or diseased brains, but could also be applied to other complex cell populations, such as the immune system.
CRISPR–Cas systems exploit viral DNA injection to establish and maintain adaptive immunity
Analysis of spacer acquisition in Staphylococcus aureus reveals that type II CRISPR–Cas systems exploit viral DNA injection to ensure a successful CRISPR immune response. Early dose of spacers enhances immunity CRISPR–Cas systems provide anti-viral and plasmid immunity in prokaryotes by acquiring short DNA sequences known as spacers from the infecting agents and using them as templates to cleave the pathogens. This report unveils a new aspect of CRISPR–Cas function by describing the timeline of spacer acquisition during infection. The timeline shows how early acquisition enhances the microbial immune response. Clustered regularly interspaced short palindromic repeats (CRISPR)–Cas systems provide protection against viral 1 and plasmid 2 infection by capturing short DNA sequences from these invaders and integrating them into the CRISPR locus of the prokaryotic host 1 . These sequences, known as spacers, are transcribed into short CRISPR RNA guides 3 , 4 , 5 that specify the cleavage site of Cas nucleases in the genome of the invader 6 , 7 , 8 . It is not known when spacer sequences are acquired during viral infection. Here, to investigate this, we tracked spacer acquisition in Staphylococcus aureus cells harbouring a type II CRISPR–Cas9 system after infection with the staphylococcal bacteriophage ϕ12. We found that new spacers were acquired immediately after infection preferentially from the cos site, the viral free DNA end that is first injected into the cell. Analysis of spacer acquisition after infection with mutant phages demonstrated that most spacers are acquired during DNA injection, but not during other stages of the viral cycle that produce free DNA ends, such as DNA replication or packaging. Finally, we showed that spacers acquired from early-injected genomic regions, which direct Cas9 cleavage of the viral DNA immediately after infection, provide better immunity than spacers acquired from late-injected regions. Our results reveal that CRISPR–Cas systems exploit the phage life cycle to generate a pattern of spacer acquisition that ensures a successful CRISPR immune response.
Phage-inducible islands in the Gram-positive cocci
The SaPIs are a cohesive subfamily of extremely common phage-inducible chromosomal islands (PICIs) that reside quiescently at specific att sites in the staphylococcal chromosome and are induced by helper phages to excise and replicate. They are usually packaged in small capsids composed of phage virion proteins, giving rise to very high transfer frequencies, which they enhance by interfering with helper phage reproduction. As the SaPIs represent a highly successful biological strategy, with many natural Staphylococcus aureus strains containing two or more, we assumed that similar elements would be widespread in the Gram-positive cocci. On the basis of resemblance to the paradigmatic SaPI genome, we have readily identified large cohesive families of similar elements in the lactococci and pneumococci/streptococci plus a few such elements in Enterococcus faecalis. Based on extensive ortholog analyses, we found that the PICI elements in the four different genera all represent distinct but parallel lineages, suggesting that they represent convergent evolution towards a highly successful lifestyle. We have characterized in depth the enterococcal element, EfCIV583, and have shown that it very closely resembles the SaPIs in functionality as well as in genome organization, setting the stage for expansion of the study of elements of this type. In summary, our findings greatly broaden the PICI family to include elements from at least three genera of cocci.
Reversal of phenotypes in MECP2 duplication mice using genetic rescue or antisense oligonucleotides
Genetic correction of MeCP2 levels largely reversed the behavioural, molecular and physiological deficits associated with MECP2 duplication syndrome in a transgenic mouse model; similarly, reduction of MeCP2 levels using an antisense oligonucleotide strategy resulted in phenotypic rescue in adult transgenic mice, and dose-dependently corrected MeCP2 levels in cells from patients with MECP2 duplication. Potential reversal of a developmental disorder MECP2 duplication syndrome is a childhood disorder caused by duplication of the MECP2 gene and, consequently, increased MECP2 protein levels. Huda Zoghbi and colleagues report that genetic correction of MECP2 levels largely reverses the behavioural, molecular and physiological deficits in a transgenic mouse model. Reducing MECP2 levels using an antisense oligonucleotide (ASO) strategy—which has greater potential for therapeutic application—similarly resulted in phenotypic rescue in adult transgenic mice and dose-dependently corrected MECP2 levels in cells from patients with MECP2 duplication. These findings suggest that a disorder caused by copy number variation can be reversed after symptoms have emerged. Copy number variations have been frequently associated with developmental delay, intellectual disability and autism spectrum disorders 1 . MECP2 duplication syndrome is one of the most common genomic rearrangements in males 2 and is characterized by autism, intellectual disability, motor dysfunction, anxiety, epilepsy, recurrent respiratory tract infections and early death 3 , 4 , 5 . The broad range of deficits caused by methyl-CpG-binding protein 2 (MeCP2) overexpression poses a daunting challenge to traditional biochemical-pathway-based therapeutic approaches. Accordingly, we sought strategies that directly target MeCP2 and are amenable to translation into clinical therapy. The first question that we addressed was whether the neurological dysfunction is reversible after symptoms set in. Reversal of phenotypes in adult symptomatic mice has been demonstrated in some models of monogenic loss-of-function neurological disorders 6 , 7 , 8 , including loss of MeCP2 in Rett syndrome 9 , indicating that, at least in some cases, the neuroanatomy may remain sufficiently intact so that correction of the molecular dysfunction underlying these disorders can restore healthy physiology. Given the absence of neurodegeneration in MECP2 duplication syndrome, we propose that restoration of normal MeCP2 levels in MECP2 duplication adult mice would rescue their phenotype. By generating and characterizing a conditional Mecp2- overexpressing mouse model, here we show that correction of MeCP2 levels largely reverses the behavioural, molecular and electrophysiological deficits. We also reduced MeCP2 using an antisense oligonucleotide strategy, which has greater translational potential. Antisense oligonucleotides are small, modified nucleic acids that can selectively hybridize with messenger RNA transcribed from a target gene and silence it 10 , 11 , and have been successfully used to correct deficits in different mouse models 12 , 13 , 14 , 15 , 16 , 17 , 18 . We find that antisense oligonucleotide treatment induces a broad phenotypic rescue in adult symptomatic transgenic MECP2 duplication mice ( MECP2 -TG) 19 , 20 , and corrected MECP2 levels in lymphoblastoid cells from MECP2 duplication patients in a dose-dependent manner.
Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment ( att ) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attP core site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs , encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysogenic strains of E. faecalis . We have found no other example of a prophage inserted into ffs , therefore, the ffs locus for ϕEf11 integration represents a novel phage attachment site. SRP functions in the transport of proteins through the cellular membrane to the periplasmic space. Integration into ffs resulted in alteration of the 3’ end of the 4.5 S RNA, where in E. coli , alterations in the same region cause defects in membrane protein insertion. Lysogens of ϕEf11 are resistant to the ϕEf11 endolysin. Since endolysin activity is dependent upon binding to cell surface receptors, it is conceivable that defective SRP function results in alteration of the endolysin receptor, preventing endolysin function.