Explore the vast range of titles available.

Immune-mediated necrotizing myopathy (IMNM) is a group of inflammatory myopathies that was distinguished from polymyositis in 2004. Most IMNMs are associated with anti-signal recognition particle (anti-SRP) or anti-3-hydroxy-3-methylglutaryl-coA reductase (anti-HMGCR) myositis-specific autoantibodies, although ~20% of patients with IMNM remain seronegative. These associations have led to three subclasses of IMNM: anti-SRP-positive IMNM, anti-HMGCR-positive IMNM and seronegative IMNM. IMNMs are frequently rapidly progressive and severe, displaying high serum creatine kinase levels, and failure to treat IMNMs effectively may lead to severe muscle impairment. In patients with seronegative IMNM, disease can be concomitant with cancer. Research into IMNM pathogenesis has shown that anti-SRP and anti-HMGCR autoantibodies cause weakness and myofibre necrosis in mice, suggesting that, as well as being diagnostic biomarkers of IMNM, they may play a key role in disease pathogenesis. Therapeutically, treatments such as rituximab or intravenous immunoglobulins can now be discussed for IMNM, and targeted therapies, such as anticomplement therapeutics, may be a future option for patients with refractory disease.The association of immune-mediated necrotizing myopathy (IMNM) with myositis-specific autoantibodies has led to the classification of three subclasses of IMNM and provided insight into the pathogenesis of, and treatment options for, these inflammatory myopathies.

Shwachman-Diamond syndrome (SDS) (OMIM #260400) is a rare inherited bone marrow failure syndrome (IBMFS) that is primarily characterized by neutropenia and exocrine pancreatic insufficiency. Seventy-five to ninety percent of patients have compound heterozygous loss-of-function mutations in the Shwachman-Bodian-Diamond syndrome (sbds) gene. Using trio whole-exome sequencing (WES) in an sbds-negative SDS family and candidate gene sequencing in additional SBDS-negative SDS cases or molecularly undiagnosed IBMFS cases, we identified 3 independent patients, each of whom carried a de novo missense variant in srp54 (encoding signal recognition particle 54 kDa). These 3 patients shared congenital neutropenia linked with various other SDS phenotypes. 3D protein modeling revealed that the 3 variants affect highly conserved amino acids within the GTPase domain of the protein that are critical for GTP and receptor binding. Indeed, we observed that the GTPase activity of the mutated proteins was impaired. The level of SRP54 mRNA in the bone marrow was 3.6-fold lower in patients with SRP54-mutations than in healthy controls. Profound reductions in neutrophil counts and chemotaxis as well as a diminished exocrine pancreas size in a SRP54-knockdown zebrafish model faithfully recapitulated the human phenotype. In conclusion, autosomal dominant mutations in SRP54, a key member of the cotranslation protein-targeting pathway, lead to syndromic neutropenia with a Shwachman-Diamond-like phenotype.

Cotranscriptional RNA folding pathways typically involve the sequential formation of folding intermediates. Existing methods for cotranscriptional RNA structure probing map the structure of nascent RNA in the context of a terminally arrested transcription elongation complex. Consequently, the rearrangement of RNA structures as nucleotides are added to the transcript can be inferred but is not assessed directly. Here, we describe l inked- m ultipoint T ranscription E longation C omplex RNA structure prob ing (TECprobe-LM), which assesses the cotranscriptional rearrangement of RNA structures by sequentially positioning E. coli RNAP at two or more points within a DNA template so that nascent RNA can be chemically probed. We validate TECprobe-LM by measuring known folding events that occur within the E. coli signal recognition particle RNA, Clostridium beijerinckii pfl ZTP riboswitch, and Bacillus cereus crcB fluoride riboswitch folding pathways. Our findings establish TECprobe-LM as a strategy for observing cotranscriptional RNA folding events directly using chemical probing. Cotranscriptional RNA folding pathways often involve the sequential formation of folding intermediates as RNA emerges from an RNA polymerase. Here the authors develop an RNA chemical probing method that directly measures the cotranscriptional rearrangement of nascent RNA structures.

Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome–nascent chain complex. The co-translational insertion of proteins into membranes requires interaction between a ribosome-bound signal recognition particle (SRP) and a membrane-bound translocon. Here the authors use cryo-EM and single particle reconstructions to obtain a comprehensive view of the co-translational protein targeting process.

Protein biogenesis is essential in all cells and initiates when a nascent polypeptide emerges from the ribosome exit tunnel, where multiple ribosome-associated protein biogenesis factors (RPBs) direct nascent proteins to distinct fates. How distinct RPBs spatiotemporally coordinate with one another to affect accurate protein biogenesis is an emerging question. Here, we address this question by studying the role of a cotranslational chaperone, nascent polypeptide-associated complex (NAC), in regulating substrate selection by signal recognition particle (SRP), a universally conserved protein targeting machine. We show that mammalian SRP and SRP receptors (SR) are insufficient to generate the biologically required specificity for protein targeting to the endoplasmic reticulum. NAC co-binds with and remodels the conformational landscape of SRP on the ribosome to regulate its interaction kinetics with SR, thereby reducing the nonspecific targeting of signalless ribosomes and pre-emptive targeting of ribosomes with short nascent chains. Mathematical modeling demonstrates that the NAC-induced regulations of SRP activity are essential for the fidelity of cotranslational protein targeting. Our work establishes a molecular model for how NAC acts as a triage factor to prevent protein mislocalization, and demonstrates how the macromolecular crowding of RPBs at the ribosome exit site enhances the fidelity of substrate selection into individual protein biogenesis pathways. Biochemistry combined with biophysical measurements and mathematical modeling offer insight into the mechanism by which the cotranslational chaperone, nascent polypeptide-associated complex (NAC), modulates substrate selection by signal recognition particle (SRP) and reduces aberrant, nonspecific targeting of ribosomes to the ER.

Key proteins of the photosynthetic complexes are encoded in the chloroplast genome and cotranslationally inserted into the thylakoid membrane. However, the molecular details of this process are largely unknown. Here, we demonstrate by ribosome profiling that the conserved chloroplast signal recognition particle subunit (cpSRP54) is required for efficient cotranslational targeting of several central photosynthetic proteins, such as the PSII PsbA (D1) subunit, in Arabidopsis (Arabidopsis thaliana). High-resolution analysis of membrane-associated and soluble ribosome footprints revealed that the SRP-dependent membrane targeting of PsbA is already initiated at an early translation step before exposure of the nascent chain from the ribosome. In contrast to cytosolic SRP, which contacts the ribosome close to the peptide tunnel exit site, analysis of the cpSRP54/ribosome binding interface revealed a direct interaction of cpSRP54 and the ribosomal subunit uL4, which is not located at the tunnel exit site but forms a part of the internal peptide tunnel wall by a loop domain. The plastid-specific C-terminal tail region of cpSRP54 plays a crucial role in uL4 binding. Our data indicate a novel mechanism of SRP-dependent membrane protein transport with the cpSRP54/uL4 interaction as a central element in early initiation of cotranslational membrane targeting.

Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment ( att ) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attP core site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs , encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysogenic strains of E. faecalis . We have found no other example of a prophage inserted into ffs , therefore, the ffs locus for ϕEf11 integration represents a novel phage attachment site. SRP functions in the transport of proteins through the cellular membrane to the periplasmic space. Integration into ffs resulted in alteration of the 3’ end of the 4.5 S RNA, where in E. coli , alterations in the same region cause defects in membrane protein insertion. Lysogens of ϕEf11 are resistant to the ϕEf11 endolysin. Since endolysin activity is dependent upon binding to cell surface receptors, it is conceivable that defective SRP function results in alteration of the endolysin receptor, preventing endolysin function.

Signal recognition particles (SRPs) are essential for regulating intracellular protein transport and secretion. Patients with tumors with high SRP9 expression tend to have a poorer overall survival. However, to the best of our knowledge, no reports have described the relationship between SRP9 localization and prognosis in pancreatic cancer. Thus, the present study aimed to investigate this relationship. Immunohistochemical staining for SRP9 using excised specimens from pancreatic cancer surgery cases without preoperative chemotherapy or radiotherapy showed that SRP9 was preferentially expressed in the nucleus of the cancerous regions in some cases, which was hardly detected in other cases, indicating that SRP9 was transported to the nucleus in the former cases. To compare the prognosis of patients with SRP9 nuclear translocation, patients were divided into two groups: Those with a nuclear translocation rate of >50% and those with a nuclear translocation rate of ≤50%. The nuclear translocation rate of >50% group had a significantly better recurrence-free survival than the nuclear translocation rate of ≤50% group (P=0.037). Subsequent in vitro experiments were conducted; notably, the nuclear translocation rate of SRP9 was reduced under amino acid-deficient conditions, suggesting that multiple factors are involved in this phenomenon. To further study the function of SRP9 nuclear translocation, in vitro experiments were performed by introducing SRP9 splicing variants (v1 and v2) and their deletion mutants lacking C-terminal regions into MiaPaCa pancreatic cancer cells. The results demonstrated that both splicing variants showed nuclear translocation regardless of the C-terminal deletions, suggesting the role of the N-terminal regions. Given that SRP9 is an RNA-binding protein, the study of RNA immunoprecipitation revealed that signaling pathways involved in cancer progression and protein translation were downregulated in nuclear-translocated v1 and v2. Undoubtedly, further studies of the nuclear translocation of SRP9 will open an avenue to optimize the precise evaluation and therapeutic control of pancreatic cancer.

RNA-binding proteins (RBPs) are a major class of proteins that interact with RNAs to change their fate or function. RBPs and the ribonucleoprotein complexes they constitute are involved in many essential cellular processes. In many cases, the molecular details of RBP:RNA interactions differ between viruses, prokaryotes and eukaryotes, making prokaryotic and viral RBPs good potential drug targets. However, targeting RBPs with small molecules has so far been met with limited success as RNA-binding sites tend to be extended, shallow and dynamic with a mixture of charged, polar and hydrophobic interactions. Here, we show that peptide nucleic acids (PNAs) with nucleic acid-like binding properties and a highly stable peptide-like backbone can be used to target some RBPs. We have designed PNAs to mimic the short RNA stem-loop sequence required for the initiation of prokaryotic signal recognition particle (SRP) assembly, a target for antibiotics development. Using a range of biophysical and biochemical assays, the designed PNAs were demonstrated to fold into a hairpin structure, bind the targeted protein and compete with the native RNA hairpin to inhibit SRP formation. To show the applicability of PNAs against other RBPs, a PNA was also shown to bind Nsp9 from SARS-CoV-2, a protein that exhibits non-sequence-specific RNA binding but preferentially binds hairpin structures. Taken together, our results support that PNAs can be a promising class of compounds for targeting RNA-binding activities in RBPs.

Non-coding 7SL RNA is an ancestor to mammalian Alu and B1 SINE RNAs and is thought to function exclusively within the Signal Recognition Particle (SRP), aiding in the translocation of secretory proteins into the endoplasmic reticulum for export. Here, we discover a function of 7SL/SRP unrelated to protein secretion. Under acute heat shock, 7SL and SRP together selectively arrest cellular transcription and translation machineries during early response to stress. Under thermal stress, 7SL is upregulated, accumulates in the nucleus, and binds to target genes repressed by heat shock. Concurrently, in the cytosol, SRP binds to ribosomes and inhibits new protein synthesis. Translational suppression occurs independently of the signal peptide and is abrogated by depleting SRP. Translation inhibition extends to the mitochondria, as nuclear-encoded genes with mitochondrial functions are enriched among SRP targets. Thus, apart from its role in protein export, 7SL/SRP orchestrates a global response to acute stress that encompasses the nucleus, cytosol, and mitochondria across transcription and translation. 7SL is traditionally thought to function within the SRP to aid in protein translocation into the ER. Here, the authors show that under acute heat shock, it selectively arrests cellular transcription and translation, independent of the signal peptide.