Asset Details
Do you wish to reserve the book?
Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle
Hey, we have placed the reservation for you!
By the way, why not check out events that you can attend while you pick your title.
Oops! Something went wrong.
Looks like we were not able to place the reservation. Kindly try again later.
Are you sure you want to remove the book from the shelf?
Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle
Do you wish to request the book?
Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle
Please be aware that the book you have requested cannot be checked out. If you would like to checkout this book, you can reserve another copy
We have requested the book for you!
Your request is successful and it will be processed during the Library working hours. Please check the status of your request in My Requests.
Oops! Something went wrong.
Looks like we were not able to place your request. Kindly try again later.
Journal Article
Identification of a novel bacteriophage attachment site into ffs, the 4.5S non-coding RNA component of the signal recognition particle
2025
Overview
Bioinformatic analysis of
Enterococcus faecalis
temperate phage ϕEf11 identified prospective
attP
and
attB
core attachment (
att
) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive
attP
core site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive
attB
site was located within
ffs
, encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software,
attL
and
attR
sequences disrupting
ffs
could only be detected in lysogenic strains of
E. faecalis
. We have found no other example of a prophage inserted into
ffs
, therefore, the
ffs
locus for ϕEf11 integration represents a novel phage attachment site. SRP functions in the transport of proteins through the cellular membrane to the periplasmic space. Integration into
ffs
resulted in alteration of the 3’ end of the 4.5 S RNA, where in
E. coli
, alterations in the same region cause defects in membrane protein insertion. Lysogens of ϕEf11 are resistant to the ϕEf11 endolysin. Since endolysin activity is dependent upon binding to cell surface receptors, it is conceivable that defective SRP function results in alteration of the endolysin receptor, preventing endolysin function.
Publisher
Nature Publishing Group UK,Nature Publishing Group,Nature Portfolio
